Incidental Mutation 'R2336:St3gal6'
ID246568
Institutional Source Beutler Lab
Gene Symbol St3gal6
Ensembl Gene ENSMUSG00000022747
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 6
Synonyms1700023B24Rik, ST3Gal VI, Siat10
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58468125-58524243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58493704 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 22 (I22K)
Ref Sequence ENSEMBL: ENSMUSP00000117849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114357] [ENSMUST00000114358] [ENSMUST00000123918] [ENSMUST00000125712] [ENSMUST00000126978] [ENSMUST00000137035] [ENSMUST00000142900] [ENSMUST00000148061] [ENSMUST00000149456] [ENSMUST00000151510]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114357
AA Change: I22K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109997
Gene: ENSMUSG00000022747
AA Change: I22K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114358
AA Change: I22K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109998
Gene: ENSMUSG00000022747
AA Change: I22K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 71 329 7.1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123918
AA Change: I22K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000125712
Predicted Effect possibly damaging
Transcript: ENSMUST00000126978
AA Change: I22K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135721
Predicted Effect possibly damaging
Transcript: ENSMUST00000137035
AA Change: I22K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115756
Gene: ENSMUSG00000022747
AA Change: I22K

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 63 329 6.2e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142900
Predicted Effect probably benign
Transcript: ENSMUST00000148061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149197
Predicted Effect possibly damaging
Transcript: ENSMUST00000149456
AA Change: I22K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000151510
Meta Mutation Damage Score 0.4880 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the sialyltransferase family. Members of this family are enzymes that transfer sialic acid from the activated cytidine 5'-monophospho-N-acetylneuraminic acid to terminal positions on sialylated glycolipids (gangliosides) or to the N- or O-linked sugar chains of glycoproteins. This protein has high specificity for neolactotetraosylceramide and neolactohexaosylceramide as glycolipid substrates and may contribute to the formation of selectin ligands and sialyl Lewis X, a carbohydrate important for cell-to-cell recognition and a blood group antigen. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit modest impairment in leukocyte rolling and neutrophil recruitment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in St3gal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:St3gal6 APN 16 58484775 missense probably benign 0.31
IGL01583:St3gal6 APN 16 58493670 unclassified probably benign
IGL02512:St3gal6 APN 16 58473459 missense probably benign 0.00
R0212:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0212:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0441:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0441:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R0442:St3gal6 UTSW 16 58473453 missense probably damaging 0.96
R0442:St3gal6 UTSW 16 58473455 missense probably damaging 1.00
R1786:St3gal6 UTSW 16 58475871 missense probably damaging 1.00
R1939:St3gal6 UTSW 16 58473561 splice site probably null
R2233:St3gal6 UTSW 16 58473534 missense probably damaging 1.00
R2274:St3gal6 UTSW 16 58488969 missense possibly damaging 0.46
R2434:St3gal6 UTSW 16 58470652 missense probably damaging 1.00
R3789:St3gal6 UTSW 16 58484773 missense probably benign 0.07
R6318:St3gal6 UTSW 16 58486406 missense probably benign 0.01
R7320:St3gal6 UTSW 16 58493711 missense probably benign 0.00
R7599:St3gal6 UTSW 16 58473437 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCGTTCCAGCAATCTACAC -3'
(R):5'- AGAACTGTTCTTTCTGTATGTTCAGCG -3'

Sequencing Primer
(F):5'- GTTCCAGCAATCTACACCCAGG -3'
(R):5'- GACCCATGTCTTTTTCTCTTCTC -3'
Posted On2014-10-30