Mutagenetix > Incidental Mutation

Incidental Mutation 'R0285:Otof'

24657

Institutional Source

Beutler Lab

Gene Symbol

Otof

Ensembl Gene

ENSMUSG00000062372

Gene Name

otoferlin

Synonyms

MMRRC Submission

038506-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R0285 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30367062-30461932 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 30379533 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000074171

SMART Domains

Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114747

SMART Domains

Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.8e-1	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC
transmembrane domain	1959	1981	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000133509

SMART Domains

Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	269	367	3.76e-11	SMART
FerI	353	424	7.91e-38	SMART
C2	432	543	1.75e-11	SMART
low complexity region	622	633	N/A	INTRINSIC
FerB	856	932	5.13e-46	SMART
C2	975	1082	1.77e-7	SMART
Pfam:C2	1153	1236	1.4e-2	PFAM
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1288	1318	N/A	INTRINSIC
low complexity region	1365	1380	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
C2	1488	1587	6.54e-11	SMART
C2	1728	1858	4.02e0	SMART
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144125

SMART Domains

Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

Domain	Start	End	E-Value	Type
C2	2	97	6.83e-1	SMART
C2	254	352	3.76e-11	SMART
FerI	338	409	7.91e-38	SMART
C2	417	528	1.75e-11	SMART
low complexity region	607	618	N/A	INTRINSIC
FerB	841	917	5.13e-46	SMART
C2	960	1067	1.77e-7	SMART
low complexity region	1191	1202	N/A	INTRINSIC
low complexity region	1265	1276	N/A	INTRINSIC
low complexity region	1293	1323	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC
low complexity region	1436	1447	N/A	INTRINSIC
C2	1493	1592	6.54e-11	SMART
C2	1733	1863	4.02e0	SMART
Pfam:Ferlin_C	1895	1994	7.2e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150734

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.1%
20x: 92.9%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011I03Rik	G	A	18: 57,533,865	G5S	probably damaging	Het
Acy3	A	G	19: 3,988,193	E162G	probably benign	Het
Angptl1	T	C	1: 156,845,215	S204P	probably benign	Het
Atf6b	C	T	17: 34,650,396		probably benign	Het
Card11	G	A	5: 140,887,101	S619F	probably damaging	Het
Ccl11	G	A	11: 82,062,258	V81I	probably damaging	Het
Cds1	T	C	5: 101,797,038	I126T	probably damaging	Het
Chd1	A	G	17: 17,374,680		probably benign	Het
Cndp1	C	A	18: 84,618,238	V384F	possibly damaging	Het
Cuta	A	G	17: 26,939,449		probably null	Het
Diaph3	G	A	14: 87,115,024	T47I	possibly damaging	Het
Dopey1	A	T	9: 86,512,639	S598C	probably damaging	Het
Dsp	A	G	13: 38,172,794	M217V	probably benign	Het
Esyt1	T	A	10: 128,512,218	I898F	possibly damaging	Het
Fam189a2	G	A	19: 23,979,385		probably benign	Het
Fam205a1	G	A	4: 42,850,236	T640M	probably benign	Het
Fam84b	T	C	15: 60,822,967	H310R	probably benign	Het
Fgd3	A	T	13: 49,263,948	W680R	possibly damaging	Het
Folh1	A	G	7: 86,742,165		probably benign	Het
Fuk	G	C	8: 110,893,717	H235Q	probably benign	Het
Gadl1	C	A	9: 116,030,738		probably benign	Het
Garem1	A	G	18: 21,129,612	M715T	probably benign	Het
Gpd2	A	T	2: 57,338,955	D257V	probably benign	Het
Hdac7	A	G	15: 97,798,222		probably null	Het
Heatr5b	A	G	17: 78,808,453	M858T	probably benign	Het
Inpp4b	A	T	8: 82,034,516		probably benign	Het
Iqgap3	G	T	3: 88,096,990	C461F	probably benign	Het
Lamb1	C	A	12: 31,326,645	C559*	probably null	Het
Lrrc31	T	C	3: 30,684,948	N308S	probably benign	Het
Ly75	T	C	2: 60,318,319	Y1222C	probably damaging	Het
Map3k10	C	A	7: 27,673,900	R42L	probably benign	Het
Meioc	A	G	11: 102,672,191	T72A	probably benign	Het
Miox	C	T	15: 89,336,274	L189F	possibly damaging	Het
Mmp11	T	C	10: 75,925,668	Y366C	probably damaging	Het
N4bp2	T	A	5: 65,806,559	D650E	probably benign	Het
Ncoa6	TGC	TGCGC	2: 155,408,291		probably null	Het
Ncoa6	T	C	2: 155,415,701	M641V	probably damaging	Het
Nol4l	G	A	2: 153,483,853		probably benign	Het
Notch1	T	G	2: 26,460,861	D2089A	possibly damaging	Het
Olfr1156	A	G	2: 87,950,131	I34T	probably damaging	Het
Olfr1419	A	G	19: 11,871,138	L26P	probably damaging	Het
Olfr1449	A	T	19: 12,935,172	M145L	probably benign	Het
Olfr155	G	A	4: 43,854,398	V30M	possibly damaging	Het
Olfr493	A	G	7: 108,346,499	S161P	probably benign	Het
Olfr649	A	T	7: 104,189,324	Y294*	probably null	Het
Olfr930	T	A	9: 38,930,774	I201N	possibly damaging	Het
Paox	T	C	7: 140,129,140	F324L	probably damaging	Het
Pycr1	A	T	11: 120,640,316	I277N	probably benign	Het
R3hcc1l	A	T	19: 42,576,129	H627L	probably damaging	Het
Rab21	G	A	10: 115,290,863	S193L	probably benign	Het
Ralgds	T	G	2: 28,550,569		probably null	Het
Rbm42	A	G	7: 30,645,840	S169P	possibly damaging	Het
Rfpl4	A	G	7: 5,110,378	V262A	probably benign	Het
Rhobtb3	A	G	13: 75,877,509	I496T	possibly damaging	Het
Rnf31	G	A	14: 55,601,389	A901T	probably damaging	Het
Ryr2	T	C	13: 11,716,977	D2359G	probably damaging	Het
Sgo2b	A	C	8: 63,928,789	Y336*	probably null	Het
Slc16a7	T	A	10: 125,294,631	I62L	probably benign	Het
Slc22a21	A	T	11: 53,959,196		probably benign	Het
Slc25a21	A	G	12: 56,858,025		probably null	Het
Slc5a4b	T	C	10: 76,062,283	I532M	probably damaging	Het
Srrm4	C	A	5: 116,467,789		probably benign	Het
Stxbp1	C	A	2: 32,823,542	E27D	probably benign	Het
Sult2a5	T	A	7: 13,628,760	Y131N	probably damaging	Het
Svopl	T	C	6: 37,984,522	Q492R	probably benign	Het
Tmem144	G	A	3: 79,839,273		probably benign	Het
Tmem87a	A	G	2: 120,394,424	S119P	probably benign	Het
Tmprss11c	A	G	5: 86,271,430	L90P	probably damaging	Het
Tmprss6	T	A	15: 78,452,868	D346V	probably damaging	Het
Ubr4	A	C	4: 139,440,801	S2820R	probably damaging	Het
Usp4	T	C	9: 108,378,564	V607A	probably benign	Het
Usp45	A	G	4: 21,798,603		probably null	Het
Vill	C	T	9: 119,070,827		probably benign	Het
Vmn1r13	C	A	6: 57,209,994	T46N	probably benign	Het
Vmn2r107	A	G	17: 20,345,611	T63A	probably benign	Het
Vmn2r82	T	A	10: 79,396,557	W797R	probably damaging	Het
Washc2	T	A	6: 116,221,839	D287E	probably damaging	Het
Xpc	G	A	6: 91,498,064	L660F	probably damaging	Het

Other mutations in Otof

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Otof	APN	5	30375904	missense	probably damaging	1.00
IGL00391:Otof	APN	5	30375623	missense	probably damaging	1.00
IGL00579:Otof	APN	5	30399322	missense	possibly damaging	0.88
IGL00671:Otof	APN	5	30385753	critical splice donor site	probably null
IGL01019:Otof	APN	5	30405216	missense	probably benign	0.01
IGL01025:Otof	APN	5	30384253	missense	possibly damaging	0.82
IGL01086:Otof	APN	5	30376273	critical splice donor site	probably null
IGL01110:Otof	APN	5	30461725	missense	probably damaging	1.00
IGL01160:Otof	APN	5	30381535	missense	probably benign	0.00
IGL01285:Otof	APN	5	30405183	missense	probably damaging	1.00
IGL01329:Otof	APN	5	30441379	missense	probably benign	0.00
IGL01337:Otof	APN	5	30405777	missense	possibly damaging	0.93
IGL01337:Otof	APN	5	30419512	missense	probably benign	0.17
IGL01834:Otof	APN	5	30399220	missense	probably damaging	1.00
IGL01872:Otof	APN	5	30379254	splice site	probably benign
IGL01969:Otof	APN	5	30382483	splice site	probably benign
IGL02075:Otof	APN	5	30370726	missense	probably benign	0.23
IGL02077:Otof	APN	5	30399235	missense	probably damaging	1.00
IGL02136:Otof	APN	5	30373992	missense	possibly damaging	0.90
IGL02227:Otof	APN	5	30370784	missense	probably damaging	1.00
IGL02475:Otof	APN	5	30376682	missense	probably damaging	1.00
IGL02812:Otof	APN	5	30374082	missense	probably benign	0.08
IGL02864:Otof	APN	5	30386341	missense	probably damaging	0.99
IGL03176:Otof	APN	5	30405176	splice site	probably null
R0421:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R0570:Otof	UTSW	5	30371881	splice site	probably benign
R0599:Otof	UTSW	5	30370705	missense	probably damaging	1.00
R0675:Otof	UTSW	5	30382361	missense	probably benign	0.01
R0715:Otof	UTSW	5	30394697	missense	probably damaging	0.99
R1019:Otof	UTSW	5	30370743	missense	probably damaging	0.96
R1183:Otof	UTSW	5	30371912	missense	probably damaging	1.00
R1435:Otof	UTSW	5	30378695	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1469:Otof	UTSW	5	30380227	missense	probably benign	0.00
R1474:Otof	UTSW	5	30379532	critical splice donor site	probably null
R1524:Otof	UTSW	5	30379556	missense	probably benign	0.03
R1563:Otof	UTSW	5	30371005	missense	probably benign	0.00
R1732:Otof	UTSW	5	30386471	missense	probably damaging	1.00
R1822:Otof	UTSW	5	30378710	missense	probably benign	0.00
R1845:Otof	UTSW	5	30371723	nonsense	probably null
R1925:Otof	UTSW	5	30394188	missense	probably benign	0.37
R1938:Otof	UTSW	5	30376369	missense	probably benign	0.00
R1968:Otof	UTSW	5	30388654	missense	probably damaging	1.00
R1996:Otof	UTSW	5	30421037	missense	probably benign	0.01
R1999:Otof	UTSW	5	30388772	missense	probably benign	0.19
R2027:Otof	UTSW	5	30421014	missense	probably benign	0.08
R2138:Otof	UTSW	5	30461770	missense	probably benign	0.01
R2173:Otof	UTSW	5	30386374	missense	probably damaging	1.00
R2245:Otof	UTSW	5	30370207	missense	probably damaging	1.00
R3011:Otof	UTSW	5	30382840	missense	probably damaging	1.00
R3105:Otof	UTSW	5	30381801	missense	probably benign	0.03
R3442:Otof	UTSW	5	30371689	missense	probably damaging	1.00
R3710:Otof	UTSW	5	30385266	missense	probably benign
R3715:Otof	UTSW	5	30376871	nonsense	probably null
R3806:Otof	UTSW	5	30386499	critical splice acceptor site	probably null
R3975:Otof	UTSW	5	30370712	missense	probably damaging	1.00
R4067:Otof	UTSW	5	30399291	missense	probably damaging	1.00
R4077:Otof	UTSW	5	30419506	missense	possibly damaging	0.89
R4166:Otof	UTSW	5	30382418	missense	probably damaging	1.00
R4451:Otof	UTSW	5	30385164	missense	possibly damaging	0.77
R4485:Otof	UTSW	5	30375000	missense	possibly damaging	0.77
R4600:Otof	UTSW	5	30371900	missense	probably damaging	1.00
R4646:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4648:Otof	UTSW	5	30383570	missense	possibly damaging	0.82
R4669:Otof	UTSW	5	30420974	critical splice donor site	probably null
R4773:Otof	UTSW	5	30394682	missense	probably benign	0.05
R4839:Otof	UTSW	5	30419404	missense	probably damaging	0.99
R4907:Otof	UTSW	5	30378661	critical splice donor site	probably null
R4961:Otof	UTSW	5	30383493	intron	probably benign
R4991:Otof	UTSW	5	30394181	missense	probably damaging	1.00
R5015:Otof	UTSW	5	30382894	missense	probably damaging	1.00
R5036:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5038:Otof	UTSW	5	30384439	missense	possibly damaging	0.54
R5253:Otof	UTSW	5	30370139	missense	probably damaging	1.00
R5336:Otof	UTSW	5	30376720	missense	probably benign	0.01
R5365:Otof	UTSW	5	30381800	missense	probably damaging	0.99
R5901:Otof	UTSW	5	30374979	missense	probably damaging	1.00
R6211:Otof	UTSW	5	30371900	missense	probably damaging	0.99
R6318:Otof	UTSW	5	30414544	missense	probably damaging	1.00
R6331:Otof	UTSW	5	30371935	missense	possibly damaging	0.94
R6671:Otof	UTSW	5	30419533	missense	probably benign
R6701:Otof	UTSW	5	30370797	nonsense	probably null
R6792:Otof	UTSW	5	30375634	missense	probably damaging	1.00
R6853:Otof	UTSW	5	30388239	missense	probably damaging	1.00
R6940:Otof	UTSW	5	30371643	missense	probably damaging	0.96
R7037:Otof	UTSW	5	30381538	missense	probably benign	0.32
R7060:Otof	UTSW	5	30388356	missense	possibly damaging	0.84
R7089:Otof	UTSW	5	30371568	missense	possibly damaging	0.94
R7165:Otof	UTSW	5	30375620	missense	probably damaging	0.99
R7178:Otof	UTSW	5	30383534	missense	possibly damaging	0.50
R7298:Otof	UTSW	5	30388270	missense	probably damaging	1.00
R7393:Otof	UTSW	5	30370270	missense	probably benign	0.45
R7397:Otof	UTSW	5	30375707	missense	probably damaging	1.00
R7400:Otof	UTSW	5	30385188	missense	probably benign	0.04
R7428:Otof	UTSW	5	30389825	missense	probably damaging	1.00
R7456:Otof	UTSW	5	30394661	missense	probably damaging	1.00
R7505:Otof	UTSW	5	30371020	missense	probably benign	0.00
R7714:Otof	UTSW	5	30370253	missense	probably damaging	0.99
R8002:Otof	UTSW	5	30380610	missense	probably benign	0.10
R8032:Otof	UTSW	5	30461798	start codon destroyed	probably benign	0.07
R8153:Otof	UTSW	5	30388735	missense	probably damaging	1.00
R8158:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8159:Otof	UTSW	5	30380194	missense	probably benign	0.37
R8441:Otof	UTSW	5	30380856	missense	probably damaging	0.99
R8738:Otof	UTSW	5	30388624	nonsense	probably null
R8813:Otof	UTSW	5	30382898	missense	probably benign	0.02
R8835:Otof	UTSW	5	30370920	missense	probably benign	0.44
R8852:Otof	UTSW	5	30371700	missense	possibly damaging	0.94
R8869:Otof	UTSW	5	30420981	missense	probably benign	0.08
R9029:Otof	UTSW	5	30370075	critical splice donor site	probably null
R9031:Otof	UTSW	5	30380188	missense	probably benign
R9061:Otof	UTSW	5	30388657	missense	possibly damaging	0.50
R9100:Otof	UTSW	5	30382352	missense	possibly damaging	0.80
R9121:Otof	UTSW	5	30379118	missense	probably benign	0.04
R9188:Otof	UTSW	5	30376751	missense	probably damaging	1.00
R9218:Otof	UTSW	5	30385125	missense	probably benign
R9280:Otof	UTSW	5	30371550	missense	probably damaging	0.98
R9395:Otof	UTSW	5	30375632	missense	probably damaging	1.00
R9400:Otof	UTSW	5	30383519	critical splice donor site	probably null
R9407:Otof	UTSW	5	30380921	missense	probably damaging	1.00
R9616:Otof	UTSW	5	30382364	missense	possibly damaging	0.95
R9665:Otof	UTSW	5	30427551	missense	probably benign	0.22
R9748:Otof	UTSW	5	30383654	missense	probably damaging	1.00
R9783:Otof	UTSW	5	30379232	missense	probably benign
Z1176:Otof	UTSW	5	30371586	missense	probably damaging	0.98
Z1177:Otof	UTSW	5	30376297	missense	probably damaging	1.00
Z1177:Otof	UTSW	5	30383658	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGAATGATTCCTATCCACTGCG -3'
(R):5'- ACCTGCTCTTCTGAATGTGAATGCC -3'

Sequencing Primer
(F):5'- ATCCACTGCGGCCATCTG -3'
(R):5'- TTATAGGCAAGAGCAAGGGGC -3'

Posted On

2013-04-16