Incidental Mutation 'R2336:Myom1'
ID246573
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2336 (G1)
Quality Score220
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71023194 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 107 (H107L)
Ref Sequence ENSEMBL: ENSMUSP00000024847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: H107L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: H107L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
AA Change: H107L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: H107L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: H107L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: H107L

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.0702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Dtwd2 A G 18: 49,700,253 probably benign Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TGAGCCACTACCAACAGGAG -3'
(R):5'- TGAAACTCTGTGGATGTCAAACAG -3'

Sequencing Primer
(F):5'- GCTGTCTACACCCATGGC -3'
(R):5'- TCAAACAGACCATAGAGGGGG -3'
Posted On2014-10-30