Incidental Mutation 'R2336:Dtwd2'
ID246574
Institutional Source Beutler Lab
Gene Symbol Dtwd2
Ensembl Gene ENSMUSG00000024505
Gene NameDTW domain containing 2
Synonyms1190002H09Rik, 8030470C17Rik
MMRRC Submission 040323-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2336 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location49696145-49755601 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 49700253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025383] [ENSMUST00000163590]
Predicted Effect probably benign
Transcript: ENSMUST00000025383
SMART Domains Protein: ENSMUSP00000025383
Gene: ENSMUSG00000024505

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
DTW 65 260 4.42e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139852
Predicted Effect probably benign
Transcript: ENSMUST00000163590
SMART Domains Protein: ENSMUSP00000128219
Gene: ENSMUSG00000024505

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 32 45 N/A INTRINSIC
DTW 65 164 3.12e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430110L20Rik T A 1: 181,227,641 noncoding transcript Het
Arhgap21 G A 2: 20,880,051 R772C probably damaging Het
Arid2 A G 15: 96,362,549 E393G probably damaging Het
Atrn C T 2: 130,957,954 T417I probably damaging Het
Baiap3 T C 17: 25,250,404 K173R probably damaging Het
Bdp1 A T 13: 100,053,002 N1497K probably damaging Het
Ceacam5 T C 7: 17,747,375 V349A probably benign Het
Chrnd T C 1: 87,194,893 F132S probably damaging Het
Ddx42 A G 11: 106,231,150 M164V possibly damaging Het
Eprs T A 1: 185,411,374 probably benign Het
Fut8 A G 12: 77,412,956 probably benign Het
Gabrr3 C T 16: 59,429,950 T104M probably damaging Het
Gcat G A 15: 79,030,980 R16H probably benign Het
Gnb2 A T 5: 137,529,198 W125R probably damaging Het
Grik4 C T 9: 42,566,355 D512N probably damaging Het
Hnf4g T C 3: 3,641,224 F60L probably benign Het
Lrp6 A G 6: 134,507,583 I359T probably damaging Het
Lrrfip2 A G 9: 111,222,215 D325G probably damaging Het
Mttp A T 3: 138,116,095 I222K possibly damaging Het
Myom1 A T 17: 71,023,194 H107L possibly damaging Het
Olfr120 A T 17: 37,726,798 Y258F probably benign Het
Olfr458 A G 6: 42,460,729 C97R probably damaging Het
Ppfia3 T C 7: 45,356,697 probably null Het
Prokr2 A T 2: 132,381,439 M61K probably damaging Het
Ptk2 A G 15: 73,266,116 C502R probably damaging Het
Rbm25 T A 12: 83,651,418 W172R probably damaging Het
Rdh16f1 A G 10: 127,788,755 K154R probably benign Het
Rnf213 G A 11: 119,414,604 E554K probably benign Het
Rnf219 G A 14: 104,478,882 P685L probably damaging Het
St3gal6 A T 16: 58,493,704 I22K probably damaging Het
Usp43 G A 11: 67,891,432 R387* probably null Het
Vmn2r106 T C 17: 20,268,208 N643S probably benign Het
Zcchc6 G T 13: 59,799,054 P585Q probably damaging Het
Zdbf2 G T 1: 63,303,464 R334L probably benign Het
Zfp868 G T 8: 69,613,907 probably null Het
Other mutations in Dtwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dtwd2 APN 18 49723709 nonsense probably null
IGL00858:Dtwd2 APN 18 49728385 missense probably damaging 1.00
R0575:Dtwd2 UTSW 18 49698472 missense probably damaging 1.00
R0691:Dtwd2 UTSW 18 49728357 splice site probably benign
R4110:Dtwd2 UTSW 18 49698306 utr 3 prime probably benign
R4543:Dtwd2 UTSW 18 49724108 splice site probably null
R4920:Dtwd2 UTSW 18 49698440 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCTTAGCACAGCTCAGTGG -3'
(R):5'- TTCTGAAGTTGCAATCTTAGGAGG -3'

Sequencing Primer
(F):5'- GCTCAGTGGGAATATTTAAATAATGC -3'
(R):5'- TTGCAATCTTAGGAGGAAGGTG -3'
Posted On2014-10-30