Incidental Mutation 'R2337:Poc5'
ID246599
Institutional Source Beutler Lab
Gene Symbol Poc5
Ensembl Gene ENSMUSG00000021671
Gene NamePOC5 centriolar protein
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2337 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96388294-96417737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96410603 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 458 (V458A)
Ref Sequence ENSEMBL: ENSMUSP00000096898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099295]
Predicted Effect probably damaging
Transcript: ENSMUST00000099295
AA Change: V458A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096898
Gene: ENSMUSG00000021671
AA Change: V458A

DomainStartEndE-ValueType
coiled coil region 175 206 N/A INTRINSIC
coiled coil region 300 341 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223478
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9930111J21Rik2 T C 11: 49,020,304 N434S probably benign Het
Acaca T C 11: 84,257,197 S691P possibly damaging Het
Arid5b T C 10: 68,097,777 D765G possibly damaging Het
Ccdc14 A G 16: 34,705,018 H179R probably benign Het
Ccdc177 C T 12: 80,758,691 A270T unknown Het
Cdh16 G T 8: 104,622,270 T65K probably benign Het
Dag1 G T 9: 108,207,397 Y848* probably null Het
Dnhd1 C T 7: 105,703,467 T2609I probably benign Het
Fat4 A G 3: 38,980,011 Y2604C probably damaging Het
Fhad1 T C 4: 141,922,344 D164G possibly damaging Het
Fnip1 G A 11: 54,475,737 D109N probably damaging Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm2046 T A 12: 87,980,178 V130E unknown Het
Gsap T A 5: 21,288,630 I755N probably damaging Het
Hdgfl2 T C 17: 56,096,987 V281A possibly damaging Het
Hmg20b T C 10: 81,348,513 E50G probably damaging Het
Myo5a A G 9: 75,203,801 D1498G probably damaging Het
Tada2b T C 5: 36,476,914 M107V probably benign Het
Tle6 T C 10: 81,592,656 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Other mutations in Poc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Poc5 APN 13 96410746 missense probably damaging 1.00
IGL01377:Poc5 APN 13 96401631 missense probably benign 0.35
IGL02981:Poc5 APN 13 96401757 critical splice donor site probably null
IGL03031:Poc5 APN 13 96401615 missense probably benign 0.00
R0348:Poc5 UTSW 13 96398866 missense probably null 1.00
R1533:Poc5 UTSW 13 96391644 missense probably damaging 0.96
R1881:Poc5 UTSW 13 96398731 missense probably benign 0.21
R2171:Poc5 UTSW 13 96410749 missense probably damaging 1.00
R3419:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R3736:Poc5 UTSW 13 96396816 missense probably damaging 1.00
R4554:Poc5 UTSW 13 96403021 missense probably benign 0.40
R5223:Poc5 UTSW 13 96402955 missense probably benign 0.20
R5436:Poc5 UTSW 13 96396813 missense probably damaging 1.00
R6089:Poc5 UTSW 13 96396671 missense probably damaging 1.00
R6700:Poc5 UTSW 13 96394495 missense probably benign 0.00
R7345:Poc5 UTSW 13 96396796 missense probably damaging 1.00
R7354:Poc5 UTSW 13 96394525 missense probably benign 0.02
R7363:Poc5 UTSW 13 96404417 missense possibly damaging 0.88
R7454:Poc5 UTSW 13 96400832 missense possibly damaging 0.93
R7773:Poc5 UTSW 13 96410635 missense probably damaging 1.00
R7786:Poc5 UTSW 13 96404519 missense possibly damaging 0.55
R7953:Poc5 UTSW 13 96402900 missense probably benign 0.27
X0019:Poc5 UTSW 13 96394548 frame shift probably null
X0024:Poc5 UTSW 13 96394548 frame shift probably null
X0034:Poc5 UTSW 13 96394548 frame shift probably null
X0035:Poc5 UTSW 13 96394548 frame shift probably null
X0036:Poc5 UTSW 13 96394548 frame shift probably null
X0037:Poc5 UTSW 13 96394548 frame shift probably null
X0038:Poc5 UTSW 13 96394548 frame shift probably null
X0039:Poc5 UTSW 13 96394548 frame shift probably null
X0040:Poc5 UTSW 13 96394548 frame shift probably null
X0052:Poc5 UTSW 13 96394548 frame shift probably null
X0053:Poc5 UTSW 13 96394548 frame shift probably null
X0054:Poc5 UTSW 13 96394548 frame shift probably null
X0058:Poc5 UTSW 13 96394548 frame shift probably null
X0060:Poc5 UTSW 13 96394548 frame shift probably null
X0061:Poc5 UTSW 13 96394548 frame shift probably null
X0062:Poc5 UTSW 13 96394548 frame shift probably null
X0063:Poc5 UTSW 13 96394548 frame shift probably null
Z1176:Poc5 UTSW 13 96401722 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGGCATGCCCAGGTTAAAG -3'
(R):5'- AATGACCGACCATGACTGTCAG -3'

Sequencing Primer
(F):5'- GCCCAGGTTAAAGAAATATTTTGGAG -3'
(R):5'- TTGACAAGTGGCAGACTTCC -3'
Posted On2014-10-30