Mutagenetix > Incidental Mutation

Incidental Mutation 'R2337:Vmn2r112'

246601

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r112

Ensembl Gene

ENSMUSG00000094921

Gene Name

vomeronasal 2, receptor 112

Synonyms

EG628185

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R2337 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22820129-22838114 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22822096 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 258 (V258E)

Ref Sequence

ENSEMBL: ENSMUSP00000094994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097381]

AlphaFold

L7N221

Predicted Effect

probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	471	2.8e-32	PFAM
Pfam:NCD3G	512	565	5.8e-21	PFAM
Pfam:7tm_3	598	833	6.5e-54	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,211,320 (GRCm39)	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,211,321 (GRCm39)	E685V	possibly damaging	Het
9930111J21Rik2	T	C	11: 48,911,131 (GRCm39)	N434S	probably benign	Het
Acaca	T	C	11: 84,148,023 (GRCm39)	S691P	possibly damaging	Het
Arid5b	T	C	10: 67,933,607 (GRCm39)	D765G	possibly damaging	Het
Ccdc14	A	G	16: 34,525,388 (GRCm39)	H179R	probably benign	Het
Ccdc177	C	T	12: 80,805,465 (GRCm39)	A270T	unknown	Het
Cdh16	G	T	8: 105,348,902 (GRCm39)	T65K	probably benign	Het
Dag1	G	T	9: 108,084,596 (GRCm39)	Y848*	probably null	Het
Dnhd1	C	T	7: 105,352,674 (GRCm39)	T2609I	probably benign	Het
Eif1ad5	T	A	12: 87,946,948 (GRCm39)	V130E	unknown	Het
Fat4	A	G	3: 39,034,160 (GRCm39)	Y2604C	probably damaging	Het
Fhad1	T	C	4: 141,649,655 (GRCm39)	D164G	possibly damaging	Het
Fnip1	G	A	11: 54,366,563 (GRCm39)	D109N	probably damaging	Het
Gfm1	A	G	3: 67,342,847 (GRCm39)	D127G	probably damaging	Het
Gsap	T	A	5: 21,493,628 (GRCm39)	I755N	probably damaging	Het
Hdgfl2	T	C	17: 56,403,987 (GRCm39)	V281A	possibly damaging	Het
Hmg20b	T	C	10: 81,184,347 (GRCm39)	E50G	probably damaging	Het
Myo5a	A	G	9: 75,111,083 (GRCm39)	D1498G	probably damaging	Het
Poc5	T	C	13: 96,547,111 (GRCm39)	V458A	probably damaging	Het
Tada2b	T	C	5: 36,634,258 (GRCm39)	M107V	probably benign	Het
Tle6	T	C	10: 81,428,490 (GRCm39)		probably null	Het
Ugcg	C	T	4: 59,207,798 (GRCm39)	P46S	probably benign	Het
Xkr7	G	A	2: 152,896,318 (GRCm39)	V391M	possibly damaging	Het

Other mutations in Vmn2r112

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Vmn2r112	APN	17	22,837,917 (GRCm39)	missense	probably benign	0.13
IGL01021:Vmn2r112	APN	17	22,837,885 (GRCm39)	missense	probably damaging	1.00
IGL01122:Vmn2r112	APN	17	22,821,988 (GRCm39)	missense	probably benign	0.00
IGL01360:Vmn2r112	APN	17	22,837,603 (GRCm39)	missense	probably benign	0.03
IGL01536:Vmn2r112	APN	17	22,824,136 (GRCm39)	missense	probably damaging	1.00
IGL02148:Vmn2r112	APN	17	22,838,013 (GRCm39)	missense	probably damaging	1.00
IGL02465:Vmn2r112	APN	17	22,833,975 (GRCm39)	missense	probably damaging	1.00
PIT4576001:Vmn2r112	UTSW	17	22,833,912 (GRCm39)	missense	probably benign	0.00
R0278:Vmn2r112	UTSW	17	22,821,987 (GRCm39)	missense	probably benign	0.44
R0328:Vmn2r112	UTSW	17	22,824,251 (GRCm39)	missense	probably benign	0.01
R0583:Vmn2r112	UTSW	17	22,837,930 (GRCm39)	missense	probably damaging	1.00
R0831:Vmn2r112	UTSW	17	22,833,980 (GRCm39)	missense	probably damaging	0.99
R1080:Vmn2r112	UTSW	17	22,837,980 (GRCm39)	missense	probably damaging	1.00
R1245:Vmn2r112	UTSW	17	22,822,228 (GRCm39)	missense	probably benign	0.03
R1321:Vmn2r112	UTSW	17	22,837,500 (GRCm39)	nonsense	probably null
R1381:Vmn2r112	UTSW	17	22,837,467 (GRCm39)	missense	probably damaging	1.00
R1514:Vmn2r112	UTSW	17	22,821,825 (GRCm39)	missense	probably benign	0.40
R1519:Vmn2r112	UTSW	17	22,837,884 (GRCm39)	missense	possibly damaging	0.83
R1572:Vmn2r112	UTSW	17	22,822,125 (GRCm39)	missense	possibly damaging	0.61
R1590:Vmn2r112	UTSW	17	22,833,989 (GRCm39)	critical splice donor site	probably null
R1640:Vmn2r112	UTSW	17	22,824,097 (GRCm39)	missense	probably benign	0.01
R2221:Vmn2r112	UTSW	17	22,820,214 (GRCm39)	missense	possibly damaging	0.86
R2223:Vmn2r112	UTSW	17	22,820,214 (GRCm39)	missense	possibly damaging	0.86
R2310:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2312:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2339:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2340:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2341:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2342:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2401:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2860:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2861:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R2926:Vmn2r112	UTSW	17	22,833,984 (GRCm39)	missense	possibly damaging	0.90
R3236:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R3237:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R3977:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R3979:Vmn2r112	UTSW	17	22,822,096 (GRCm39)	missense	probably damaging	0.98
R4168:Vmn2r112	UTSW	17	22,822,069 (GRCm39)	missense	probably benign	0.01
R4256:Vmn2r112	UTSW	17	22,837,393 (GRCm39)	missense	probably damaging	1.00
R4386:Vmn2r112	UTSW	17	22,820,303 (GRCm39)	missense	probably benign	0.36
R4912:Vmn2r112	UTSW	17	22,822,363 (GRCm39)	missense	probably damaging	0.99
R4947:Vmn2r112	UTSW	17	22,821,860 (GRCm39)	missense	probably benign	0.02
R5446:Vmn2r112	UTSW	17	22,837,231 (GRCm39)	missense	probably damaging	1.00
R5870:Vmn2r112	UTSW	17	22,838,004 (GRCm39)	missense	probably benign	0.00
R6351:Vmn2r112	UTSW	17	22,820,259 (GRCm39)	missense	probably benign
R6384:Vmn2r112	UTSW	17	22,824,136 (GRCm39)	missense	probably damaging	1.00
R6390:Vmn2r112	UTSW	17	22,824,230 (GRCm39)	missense	probably benign	0.01
R6401:Vmn2r112	UTSW	17	22,822,532 (GRCm39)	nonsense	probably null
R6405:Vmn2r112	UTSW	17	22,837,216 (GRCm39)	missense	probably damaging	1.00
R6620:Vmn2r112	UTSW	17	22,822,082 (GRCm39)	missense	probably benign	0.00
R6648:Vmn2r112	UTSW	17	22,837,467 (GRCm39)	missense	probably damaging	1.00
R6649:Vmn2r112	UTSW	17	22,820,160 (GRCm39)	missense	probably null	1.00
R6653:Vmn2r112	UTSW	17	22,820,160 (GRCm39)	missense	probably null	1.00
R6654:Vmn2r112	UTSW	17	22,822,450 (GRCm39)	missense	possibly damaging	0.89
R6700:Vmn2r112	UTSW	17	22,822,462 (GRCm39)	missense	possibly damaging	0.53
R6993:Vmn2r112	UTSW	17	22,822,195 (GRCm39)	missense	probably benign	0.01
R7052:Vmn2r112	UTSW	17	22,821,507 (GRCm39)	missense	probably benign
R7454:Vmn2r112	UTSW	17	22,822,288 (GRCm39)	missense	probably benign	0.00
R7763:Vmn2r112	UTSW	17	22,822,099 (GRCm39)	missense	probably damaging	1.00
R8032:Vmn2r112	UTSW	17	22,822,375 (GRCm39)	missense	probably benign	0.21
R8177:Vmn2r112	UTSW	17	22,822,594 (GRCm39)	missense	possibly damaging	0.47
R8263:Vmn2r112	UTSW	17	22,824,140 (GRCm39)	missense	probably damaging	1.00
R8395:Vmn2r112	UTSW	17	22,837,587 (GRCm39)	missense	possibly damaging	0.94
R8492:Vmn2r112	UTSW	17	22,821,470 (GRCm39)	missense	probably benign	0.03
R8889:Vmn2r112	UTSW	17	22,837,612 (GRCm39)	missense	probably damaging	1.00
R8892:Vmn2r112	UTSW	17	22,837,612 (GRCm39)	missense	probably damaging	1.00
R9246:Vmn2r112	UTSW	17	22,824,088 (GRCm39)	missense	probably benign	0.21
R9269:Vmn2r112	UTSW	17	22,820,213 (GRCm39)	missense	probably benign
R9273:Vmn2r112	UTSW	17	22,837,721 (GRCm39)	missense	probably damaging	1.00
R9288:Vmn2r112	UTSW	17	22,822,323 (GRCm39)	missense	probably damaging	1.00
R9352:Vmn2r112	UTSW	17	22,822,479 (GRCm39)	missense	probably damaging	0.98
R9406:Vmn2r112	UTSW	17	22,824,223 (GRCm39)	nonsense	probably null
R9432:Vmn2r112	UTSW	17	22,821,233 (GRCm39)	missense
R9728:Vmn2r112	UTSW	17	22,824,108 (GRCm39)	missense	probably damaging	0.96
Z1088:Vmn2r112	UTSW	17	22,824,059 (GRCm39)	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- GGCCTCTGATCATACATCTCTAGC -3'
(R):5'- TGACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GATCATACATCTCTAGCCCTTGC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'

Posted On

2014-10-30