Mutagenetix > Incidental Mutation

Incidental Mutation 'R2338:Trmt1l'

246607

Institutional Source

Beutler Lab

Gene Symbol

Trmt1l

Ensembl Gene

ENSMUSG00000053286

Gene Name

tRNA methyltransferase 1 like

Synonyms

Trm1-like, 1190005F20Rik

MMRRC Submission

040324-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2338 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

151428542-151458161 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 151428959 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000140009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000065625] [ENSMUST00000111883] [ENSMUST00000189655]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000064771

SMART Domains

Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748

Domain	Start	End	E-Value	Type
low complexity region	186	206	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
PINc	395	522	1.94e-9	SMART
low complexity region	783	793	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000065625
AA Change: S28L

SMART Domains

Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286
AA Change: S28L

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	25	70	N/A	INTRINSIC
ZnF_C2H2	116	142	7.49e0	SMART
ZnF_C2H2	181	203	2.49e-1	SMART
Pfam:TRM	220	563	6.9e-60	PFAM
Pfam:TRM	595	684	6.8e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111883

SMART Domains

Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748

Domain	Start	End	E-Value	Type
low complexity region	186	206	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
low complexity region	258	269	N/A	INTRINSIC
PINc	395	522	1.94e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186244

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188179

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188679

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188843

Predicted Effect

probably benign
Transcript: ENSMUST00000189655

SMART Domains

Protein: ENSMUSP00000140009
Gene: ENSMUSG00000053286

Domain	Start	End	E-Value	Type
ZnF_C2H2	28	50	1.1e-3	SMART

Meta Mutation Damage Score

0.0655

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.5%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has some similarity to N2,N2-dimethylguanosine tRNA methyltransferase from other organisms. Studies of the mouse ortholog have shown that this protein plays a role in motor coordination and exploratory behavior, and it may also be involved in modulating postnatal neuronal functions. Alternatively spliced transcripts have been identified for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and anatomically normal but display significantly impaired motor coordination and aberrant exploratory behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	A	G	14: 36,095,152	D53G	probably benign	Het
4931440F15Rik	C	A	11: 29,823,718	A580S	probably benign	Het
A1cf	C	T	19: 31,932,545	P330S	probably benign	Het
A830010M20Rik	T	C	5: 107,510,574	L1158S	probably damaging	Het
Acta2	A	G	19: 34,248,541		probably benign	Het
Actrt3	A	G	3: 30,597,836	*370R	probably null	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Cadps2	C	G	6: 23,838,978		probably benign	Het
Camsap3	C	T	8: 3,606,808	R1048C	probably damaging	Het
Cdkl2	C	T	5: 92,033,679	A148T	possibly damaging	Het
Dab2	T	A	15: 6,435,252	I395K	possibly damaging	Het
Dclk2	A	G	3: 86,799,017	F589S	probably damaging	Het
Ddx60	T	C	8: 62,012,436	S1376P	possibly damaging	Het
Eprs	T	C	1: 185,415,808	F1256L	probably damaging	Het
Etaa1	A	T	11: 17,945,605		probably null	Het
Fat2	T	C	11: 55,311,901	T116A	possibly damaging	Het
Fmnl3	T	C	15: 99,370,227	T26A	probably benign	Het
Foxp1	A	G	6: 99,003,293	V158A	possibly damaging	Het
G6pd2	T	A	5: 61,810,008	D375E	probably benign	Het
Gne	C	T	4: 44,042,196	A460T	probably damaging	Het
Gprin1	T	A	13: 54,738,425		probably null	Het
Hecw2	T	C	1: 53,904,422	M949V	possibly damaging	Het
Herc1	G	A	9: 66,428,969	V1599M	possibly damaging	Het
Hk2	A	C	6: 82,731,115	N628K	probably damaging	Het
Hmcn1	T	C	1: 150,622,934	T4065A	possibly damaging	Het
Ipo8	T	A	6: 148,789,823	Q683L	probably benign	Het
Krt81	A	G	15: 101,463,336	I121T	probably benign	Het
Lamb2	T	C	9: 108,482,141	L322P	probably benign	Het
Lilrb4a	A	G	10: 51,491,700	M113V	probably benign	Het
Mnat1	G	A	12: 73,219,143		probably null	Het
Mucl1	T	A	15: 103,753,698	T68S	possibly damaging	Het
Npnt	G	T	3: 132,891,409	D461E	probably damaging	Het
Nrp1	A	T	8: 128,497,904	Q716L	probably benign	Het
Olfr358	T	G	2: 37,005,147	S156R	probably damaging	Het
Olfr623	A	T	7: 103,660,410	I280N	possibly damaging	Het
Olfr741	A	G	14: 50,485,640	T61A	possibly damaging	Het
Podxl2	T	C	6: 88,849,196	Q376R	probably damaging	Het
Pudp	T	C	18: 50,568,575	D29G	probably benign	Het
Rrs1	C	A	1: 9,545,801		probably null	Het
S1pr3	T	C	13: 51,419,578	I265T	possibly damaging	Het
Scgb1b2	A	T	7: 31,291,613	C23*	probably null	Het
Spag8	G	T	4: 43,652,826	R212S	probably benign	Het
Tacc2	A	G	7: 130,733,569		probably null	Het
Trpa1	A	T	1: 14,884,245	L810Q	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt3a1	T	A	15: 9,291,973		probably benign	Het
Vmn2r23	T	G	6: 123,704,425	I97M	possibly damaging	Het
Vmn2r65	A	T	7: 84,940,843	F622I	possibly damaging	Het
Vps13a	C	T	19: 16,720,453	G766E	probably damaging	Het
Wnk1	T	C	6: 119,969,534	T553A	probably benign	Het
Xirp2	T	A	2: 67,510,770	D1118E	probably damaging	Het
Zfyve9	A	C	4: 108,660,614	D461E	probably damaging	Het

Other mutations in Trmt1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00790:Trmt1l	APN	1	151442712	critical splice donor site	probably null
IGL02175:Trmt1l	APN	1	151448484	missense	probably benign	0.00
IGL02348:Trmt1l	APN	1	151450006	missense	probably damaging	1.00
IGL02397:Trmt1l	APN	1	151439531	missense	probably damaging	1.00
IGL02582:Trmt1l	APN	1	151433785	splice site	probably benign
IGL03150:Trmt1l	APN	1	151453892	missense	probably benign	0.00
IGL03220:Trmt1l	APN	1	151440941	splice site	probably benign
Canyonlands	UTSW	1	151454048	nonsense	probably null
splendiforous	UTSW	1	151453148	missense	probably damaging	1.00
IGL03014:Trmt1l	UTSW	1	151457930	missense	probably damaging	0.99
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0067:Trmt1l	UTSW	1	151448380	missense	probably benign	0.16
R0240:Trmt1l	UTSW	1	151457454	unclassified	probably benign
R0267:Trmt1l	UTSW	1	151457675	unclassified	probably benign
R2084:Trmt1l	UTSW	1	151440854	missense	probably damaging	1.00
R2206:Trmt1l	UTSW	1	151435843	critical splice donor site	probably null
R2408:Trmt1l	UTSW	1	151439516	missense	possibly damaging	0.48
R2429:Trmt1l	UTSW	1	151433830	missense	probably damaging	1.00
R2520:Trmt1l	UTSW	1	151453945	missense	probably benign	0.14
R3972:Trmt1l	UTSW	1	151433883	missense	possibly damaging	0.91
R4092:Trmt1l	UTSW	1	151455033	missense	probably benign	0.18
R4361:Trmt1l	UTSW	1	151435875	intron	probably benign
R4411:Trmt1l	UTSW	1	151452154	missense	probably benign	0.02
R4419:Trmt1l	UTSW	1	151440808	missense	probably damaging	0.98
R4518:Trmt1l	UTSW	1	151448343	nonsense	probably null
R4614:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4617:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4618:Trmt1l	UTSW	1	151454048	nonsense	probably null
R4647:Trmt1l	UTSW	1	151457881	missense	possibly damaging	0.86
R4653:Trmt1l	UTSW	1	151439569	missense	probably benign	0.00
R4734:Trmt1l	UTSW	1	151442637	missense	probably benign	0.32
R4873:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R4875:Trmt1l	UTSW	1	151455004	missense	probably benign	0.04
R5026:Trmt1l	UTSW	1	151440876	missense	probably damaging	1.00
R5528:Trmt1l	UTSW	1	151454995	missense	probably benign
R5587:Trmt1l	UTSW	1	151435704	intron	probably benign
R5872:Trmt1l	UTSW	1	151440843	missense	probably damaging	1.00
R6060:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
R6169:Trmt1l	UTSW	1	151428953	intron	probably benign
R6333:Trmt1l	UTSW	1	151453934	missense	probably benign	0.15
R6906:Trmt1l	UTSW	1	151452175	missense	probably benign	0.03
R7269:Trmt1l	UTSW	1	151457788	missense	possibly damaging	0.81
R7574:Trmt1l	UTSW	1	151440840	missense	possibly damaging	0.95
R7740:Trmt1l	UTSW	1	151440888	missense	possibly damaging	0.47
R7760:Trmt1l	UTSW	1	151442674	missense	possibly damaging	0.93
R7984:Trmt1l	UTSW	1	151435738	missense	probably benign	0.02
R8257:Trmt1l	UTSW	1	151428878	start codon destroyed	probably null
R8286:Trmt1l	UTSW	1	151457792	missense	probably damaging	1.00
R8439:Trmt1l	UTSW	1	151449976	missense	probably benign	0.10
R8451:Trmt1l	UTSW	1	151448288	missense	unknown
R8514:Trmt1l	UTSW	1	151453991	missense	probably damaging	0.98
R9287:Trmt1l	UTSW	1	151453148	missense	probably damaging	1.00
R9423:Trmt1l	UTSW	1	151450066	missense	possibly damaging	0.90
R9622:Trmt1l	UTSW	1	151428959	nonsense	probably null
X0039:Trmt1l	UTSW	1	151454990	missense	possibly damaging	0.88
Z1176:Trmt1l	UTSW	1	151453113	missense	possibly damaging	0.72
Z1187:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1189:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1190:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78
Z1192:Trmt1l	UTSW	1	151457580	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TTTGTCTGTGGCACGCGTAC -3'
(R):5'- AGGCATGGTTTCTCGCTTC -3'

Sequencing Primer
(F):5'- GCGTACAGCCTTCCCAATTG -3'
(R):5'- GCATGGTTTCTCGCTTCTCTGC -3'

Posted On

2014-10-30