Incidental Mutation 'R0285:Card11'
ID24662
Institutional Source Beutler Lab
Gene Symbol Card11
Ensembl Gene ENSMUSG00000036526
Gene Namecaspase recruitment domain family, member 11
SynonymsCARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
MMRRC Submission 038506-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0285 (G1)
Quality Score182
Status Validated
Chromosome5
Chromosomal Location140872990-141000582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 140887101 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 619 (S619F)
Ref Sequence ENSEMBL: ENSMUSP00000082941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085786]
Predicted Effect probably damaging
Transcript: ENSMUST00000085786
AA Change: S619F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082941
Gene: ENSMUSG00000036526
AA Change: S619F

DomainStartEndE-ValueType
Pfam:CARD 23 109 1.3e-23 PFAM
coiled coil region 176 440 N/A INTRINSIC
low complexity region 475 487 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 615 625 N/A INTRINSIC
PDZ 674 755 2.73e-1 SMART
Blast:SH3 776 838 1e-10 BLAST
low complexity region 839 850 N/A INTRINSIC
low complexity region 920 934 N/A INTRINSIC
SCOP:d1kjwa2 970 1149 1e-18 SMART
Blast:GuKc 973 1139 1e-102 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196169
Meta Mutation Damage Score 0.1374 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the membrane-associated guanylate kinase (MAGUK) family, a class of proteins that functions as molecular scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. This protein is also a member of the CARD protein family, which is defined by carrying a characteristic caspase-associated recruitment domain (CARD). This protein has a domain structure similar to that of CARD14 protein. The CARD domains of both proteins have been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. When expressed in cells, this protein activated NF-kappaB and induced the phosphorylation of BCL10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit defects in antigen receptor signalling in both T and B lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,533,865 G5S probably damaging Het
Acy3 A G 19: 3,988,193 E162G probably benign Het
Angptl1 T C 1: 156,845,215 S204P probably benign Het
Atf6b C T 17: 34,650,396 probably benign Het
Ccl11 G A 11: 82,062,258 V81I probably damaging Het
Cds1 T C 5: 101,797,038 I126T probably damaging Het
Chd1 A G 17: 17,374,680 probably benign Het
Cndp1 C A 18: 84,618,238 V384F possibly damaging Het
Cuta A G 17: 26,939,449 probably null Het
Diaph3 G A 14: 87,115,024 T47I possibly damaging Het
Dopey1 A T 9: 86,512,639 S598C probably damaging Het
Dsp A G 13: 38,172,794 M217V probably benign Het
Esyt1 T A 10: 128,512,218 I898F possibly damaging Het
Fam189a2 G A 19: 23,979,385 probably benign Het
Fam205a1 G A 4: 42,850,236 T640M probably benign Het
Fam84b T C 15: 60,822,967 H310R probably benign Het
Fgd3 A T 13: 49,263,948 W680R possibly damaging Het
Folh1 A G 7: 86,742,165 probably benign Het
Fuk G C 8: 110,893,717 H235Q probably benign Het
Gadl1 C A 9: 116,030,738 probably benign Het
Garem1 A G 18: 21,129,612 M715T probably benign Het
Gpd2 A T 2: 57,338,955 D257V probably benign Het
Hdac7 A G 15: 97,798,222 probably null Het
Heatr5b A G 17: 78,808,453 M858T probably benign Het
Inpp4b A T 8: 82,034,516 probably benign Het
Iqgap3 G T 3: 88,096,990 C461F probably benign Het
Lamb1 C A 12: 31,326,645 C559* probably null Het
Lrrc31 T C 3: 30,684,948 N308S probably benign Het
Ly75 T C 2: 60,318,319 Y1222C probably damaging Het
Map3k10 C A 7: 27,673,900 R42L probably benign Het
Meioc A G 11: 102,672,191 T72A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp11 T C 10: 75,925,668 Y366C probably damaging Het
N4bp2 T A 5: 65,806,559 D650E probably benign Het
Ncoa6 T C 2: 155,415,701 M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nol4l G A 2: 153,483,853 probably benign Het
Notch1 T G 2: 26,460,861 D2089A possibly damaging Het
Olfr1156 A G 2: 87,950,131 I34T probably damaging Het
Olfr1419 A G 19: 11,871,138 L26P probably damaging Het
Olfr1449 A T 19: 12,935,172 M145L probably benign Het
Olfr155 G A 4: 43,854,398 V30M possibly damaging Het
Olfr493 A G 7: 108,346,499 S161P probably benign Het
Olfr649 A T 7: 104,189,324 Y294* probably null Het
Olfr930 T A 9: 38,930,774 I201N possibly damaging Het
Otof C T 5: 30,379,533 probably null Het
Paox T C 7: 140,129,140 F324L probably damaging Het
Pycr1 A T 11: 120,640,316 I277N probably benign Het
R3hcc1l A T 19: 42,576,129 H627L probably damaging Het
Rab21 G A 10: 115,290,863 S193L probably benign Het
Ralgds T G 2: 28,550,569 probably null Het
Rbm42 A G 7: 30,645,840 S169P possibly damaging Het
Rfpl4 A G 7: 5,110,378 V262A probably benign Het
Rhobtb3 A G 13: 75,877,509 I496T possibly damaging Het
Rnf31 G A 14: 55,601,389 A901T probably damaging Het
Ryr2 T C 13: 11,716,977 D2359G probably damaging Het
Sgo2b A C 8: 63,928,789 Y336* probably null Het
Slc16a7 T A 10: 125,294,631 I62L probably benign Het
Slc22a21 A T 11: 53,959,196 probably benign Het
Slc25a21 A G 12: 56,858,025 probably null Het
Slc5a4b T C 10: 76,062,283 I532M probably damaging Het
Srrm4 C A 5: 116,467,789 probably benign Het
Stxbp1 C A 2: 32,823,542 E27D probably benign Het
Sult2a5 T A 7: 13,628,760 Y131N probably damaging Het
Svopl T C 6: 37,984,522 Q492R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Tmprss11c A G 5: 86,271,430 L90P probably damaging Het
Tmprss6 T A 15: 78,452,868 D346V probably damaging Het
Ubr4 A C 4: 139,440,801 S2820R probably damaging Het
Usp4 T C 9: 108,378,564 V607A probably benign Het
Usp45 A G 4: 21,798,603 probably null Het
Vill C T 9: 119,070,827 probably benign Het
Vmn1r13 C A 6: 57,209,994 T46N probably benign Het
Vmn2r107 A G 17: 20,345,611 T63A probably benign Het
Vmn2r82 T A 10: 79,396,557 W797R probably damaging Het
Washc2 T A 6: 116,221,839 D287E probably damaging Het
Xpc G A 6: 91,498,064 L660F probably damaging Het
Other mutations in Card11
AlleleSourceChrCoordTypePredicted EffectPPH Score
unmodulated APN 5 140897997 intron probably benign
IGL00961:Card11 APN 5 140899709 missense probably damaging 0.97
IGL01645:Card11 APN 5 140878023 missense probably benign 0.00
IGL01731:Card11 APN 5 140882302 missense possibly damaging 0.89
IGL01782:Card11 APN 5 140927726 start codon destroyed probably null 0.02
IGL01935:Card11 APN 5 140883546 missense possibly damaging 0.62
IGL01991:Card11 APN 5 140913378 missense possibly damaging 0.63
IGL02447:Card11 APN 5 140906924 missense possibly damaging 0.93
IGL02583:Card11 APN 5 140878126 missense probably benign 0.10
IGL03255:Card11 APN 5 140898331 missense possibly damaging 0.73
Caravaggio UTSW 5 140913309 missense probably damaging 1.00
Dealer UTSW 5 140885877 missense probably damaging 1.00
hubei UTSW 5 140906767 missense probably damaging 0.96
king UTSW 5 140891080 splice site probably benign
may UTSW 5 140876495 nonsense probably null
Poker UTSW 5 140878082 missense probably benign
Sharp UTSW 5 140876425 missense possibly damaging 0.93
Tumnus UTSW 5 140885945 missense possibly damaging 0.75
unmodulated2 UTSW 5 140883782 splice site probably null
PIT4243001:Card11 UTSW 5 140908604 missense possibly damaging 0.95
PIT4486001:Card11 UTSW 5 140876408 missense probably damaging 1.00
PIT4531001:Card11 UTSW 5 140906660 missense probably damaging 0.99
R0046:Card11 UTSW 5 140908524 missense possibly damaging 0.92
R0452:Card11 UTSW 5 140880370 missense probably benign 0.01
R1486:Card11 UTSW 5 140876519 missense probably benign
R1710:Card11 UTSW 5 140902905 nonsense probably null
R1733:Card11 UTSW 5 140906633 missense possibly damaging 0.88
R1817:Card11 UTSW 5 140885560 missense probably benign 0.00
R1818:Card11 UTSW 5 140885560 missense probably benign 0.00
R2027:Card11 UTSW 5 140906767 missense probably damaging 0.96
R2436:Card11 UTSW 5 140882362 missense possibly damaging 0.89
R2904:Card11 UTSW 5 140889133 missense probably benign 0.09
R3706:Card11 UTSW 5 140887135 missense probably damaging 0.99
R3708:Card11 UTSW 5 140887135 missense probably damaging 0.99
R4778:Card11 UTSW 5 140883782 splice site probably null
R4877:Card11 UTSW 5 140885877 missense probably damaging 1.00
R4889:Card11 UTSW 5 140885945 missense possibly damaging 0.75
R4910:Card11 UTSW 5 140874414 missense probably damaging 1.00
R5011:Card11 UTSW 5 140876520 missense possibly damaging 0.93
R5257:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5258:Card11 UTSW 5 140876425 missense possibly damaging 0.93
R5682:Card11 UTSW 5 140902911 nonsense probably null
R5754:Card11 UTSW 5 140899769 missense probably damaging 0.99
R5873:Card11 UTSW 5 140908638 missense probably damaging 1.00
R6184:Card11 UTSW 5 140898278 missense probably damaging 1.00
R6792:Card11 UTSW 5 140913309 missense probably damaging 1.00
R6825:Card11 UTSW 5 140878082 missense probably benign
R7008:Card11 UTSW 5 140873393 missense probably damaging 1.00
R7291:Card11 UTSW 5 140901070 missense probably damaging 1.00
R7376:Card11 UTSW 5 140898238 missense probably benign 0.01
R7526:Card11 UTSW 5 140913429 intron probably null
R7683:Card11 UTSW 5 140896026 missense probably benign
R7730:Card11 UTSW 5 140885996 missense probably damaging 0.96
R7813:Card11 UTSW 5 140899664 missense probably damaging 1.00
R7831:Card11 UTSW 5 140873412 missense possibly damaging 0.61
R7911:Card11 UTSW 5 140882000 critical splice donor site probably null
R7914:Card11 UTSW 5 140873412 missense possibly damaging 0.61
R7992:Card11 UTSW 5 140882000 critical splice donor site probably null
V7732:Card11 UTSW 5 140876495 nonsense probably null
X0067:Card11 UTSW 5 140885592 missense possibly damaging 0.60
Z1177:Card11 UTSW 5 140898241 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCCCTCAGTTAGGGAAGTGAAAAGATG -3'
(R):5'- TAAGAGCTGTAGGGTTCTCACCCCAG -3'

Sequencing Primer
(F):5'- cctatccctgtacccttctctg -3'
(R):5'- tgtgagagatggaggcagg -3'
Posted On2013-04-16