Incidental Mutation 'R2338:A830010M20Rik'
ID246620
Institutional Source Beutler Lab
Gene Symbol A830010M20Rik
Ensembl Gene ENSMUSG00000111375
Gene NameRIKEN cDNA A830010M20 gene
Synonyms
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2338 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107437997-107511207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107510574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 1158 (L1158S)
Ref Sequence ENSEMBL: ENSMUSP00000098511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060553] [ENSMUST00000100951] [ENSMUST00000112671] [ENSMUST00000152474] [ENSMUST00000160160] [ENSMUST00000211896]
Predicted Effect probably benign
Transcript: ENSMUST00000060553
Predicted Effect probably damaging
Transcript: ENSMUST00000100951
AA Change: L1158S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098511
Gene: ENSMUSG00000111375
AA Change: L1158S

DomainStartEndE-ValueType
low complexity region 340 353 N/A INTRINSIC
low complexity region 698 709 N/A INTRINSIC
low complexity region 946 957 N/A INTRINSIC
Pfam:DUF4596 1195 1239 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112671
SMART Domains Protein: ENSMUSP00000108290
Gene: ENSMUSG00000111375

DomainStartEndE-ValueType
low complexity region 340 353 N/A INTRINSIC
low complexity region 698 709 N/A INTRINSIC
low complexity region 946 957 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133800
Predicted Effect probably benign
Transcript: ENSMUST00000143074
SMART Domains Protein: ENSMUSP00000122032
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 364 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152474
SMART Domains Protein: ENSMUSP00000114881
Gene: ENSMUSG00000111375

DomainStartEndE-ValueType
low complexity region 339 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160160
SMART Domains Protein: ENSMUSP00000124398
Gene: ENSMUSG00000106631

DomainStartEndE-ValueType
Pfam:DUF4580 10 140 1.5e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211896
AA Change: L1670S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in A830010M20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:A830010M20Rik APN 5 107508580 missense probably damaging 1.00
IGL02638:A830010M20Rik APN 5 107508556 missense possibly damaging 0.87
IGL03001:A830010M20Rik APN 5 107497842 missense probably damaging 1.00
IGL03007:A830010M20Rik APN 5 107503676 missense probably benign 0.37
IGL03008:A830010M20Rik APN 5 107491598 splice site probably null
IGL03281:A830010M20Rik APN 5 107503876 missense probably benign 0.02
R0206:A830010M20Rik UTSW 5 107505040 missense probably benign 0.00
R0426:A830010M20Rik UTSW 5 107510373 missense probably damaging 1.00
R0765:A830010M20Rik UTSW 5 107506934 missense probably benign 0.14
R1747:A830010M20Rik UTSW 5 107451999 missense probably damaging 1.00
R2013:A830010M20Rik UTSW 5 107510789 missense probably damaging 0.99
R3963:A830010M20Rik UTSW 5 107507356 missense probably damaging 0.99
R4460:A830010M20Rik UTSW 5 107503765 missense possibly damaging 0.74
R4776:A830010M20Rik UTSW 5 107510451 missense probably damaging 0.99
R4909:A830010M20Rik UTSW 5 107507310 nonsense probably null
R5105:A830010M20Rik UTSW 5 107510471 missense possibly damaging 0.70
R5155:A830010M20Rik UTSW 5 107490703 missense probably damaging 0.96
R6089:A830010M20Rik UTSW 5 107507029 missense probably damaging 0.99
R7282:A830010M20Rik UTSW 5 107507196 missense probably benign
R7282:A830010M20Rik UTSW 5 107510505 missense probably damaging 0.99
R7492:A830010M20Rik UTSW 5 107510507 missense probably benign 0.01
R8087:A830010M20Rik UTSW 5 107485087 missense probably damaging 1.00
R8694:A830010M20Rik UTSW 5 107510769 missense probably benign 0.02
R8777:A830010M20Rik UTSW 5 107510427 missense probably damaging 0.99
R8777-TAIL:A830010M20Rik UTSW 5 107510427 missense probably damaging 0.99
R8788:A830010M20Rik UTSW 5 107470987 makesense probably null
Predicted Primers PCR Primer
(F):5'- ACCTCCATGTATGACCACCG -3'
(R):5'- CCTTGAGGCGAACAATCTGTG -3'

Sequencing Primer
(F):5'- ATGTATGACCACCGGCCTTC -3'
(R):5'- TCTGTGGAAGAAACACTAGCC -3'
Posted On2014-10-30