Incidental Mutation 'R2338:Cadps2'
ID 246621
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2338 (G1)
Quality Score 101
Status Validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to G at 23838978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000018122
AA Change: G54R
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000069074
AA Change: G54R
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115355
SMART Domains Protein: ENSMUSP00000111012
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115356
AA Change: G54R
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115358
AA Change: G54R
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000115361
AA Change: G54R
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136279
Predicted Effect probably benign
Transcript: ENSMUST00000142913
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163871
AA Change: G54R
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: G54R

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Meta Mutation Damage Score 0.0947 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9228:Cadps2 UTSW 6 23688928 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAGTGTCCAGCCCTTCGC -3'
(R):5'- AACTCGACGTGTCCGGAAAG -3'

Sequencing Primer
(F):5'- AGGTGCCCTGAACTCTCC -3'
(R):5'- AAAGCCCGGGCCACTTTC -3'
Posted On 2014-10-30