Incidental Mutation 'R2338:Foxp1'
ID246624
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Nameforkhead box P1
Synonyms4932443N09Rik, 3110052D19Rik
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2338 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location98925338-99522721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99003293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 158 (V158A)
Ref Sequence ENSEMBL: ENSMUSP00000121404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000123992] [ENSMUST00000124058] [ENSMUST00000154163] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177229] [ENSMUST00000177230] [ENSMUST00000177307] [ENSMUST00000177437]
Predicted Effect probably benign
Transcript: ENSMUST00000074346
AA Change: V287A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: V287A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113321
SMART Domains Protein: ENSMUSP00000108947
Gene: ENSMUSG00000030067

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113322
AA Change: V287A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: V287A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113324
AA Change: V288A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: V288A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113326
AA Change: V255A
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: V255A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113328
AA Change: V288A

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: V288A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113329
AA Change: V287A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: V287A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123992
SMART Domains Protein: ENSMUSP00000117550
Gene: ENSMUSG00000030067

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124058
AA Change: V158A

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120244
Gene: ENSMUSG00000030067
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142164
Predicted Effect possibly damaging
Transcript: ENSMUST00000154163
AA Change: V158A

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121404
Gene: ENSMUSG00000030067
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176565
AA Change: V288A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: V288A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176632
AA Change: V256A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: V256A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176850
AA Change: V257A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: V257A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177229
AA Change: V159A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134817
Gene: ENSMUSG00000030067
AA Change: V159A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
ZnF_C2H2 206 231 8.67e-1 SMART
low complexity region 243 255 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
FH 363 444 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177230
AA Change: V257A

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: V257A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177307
AA Change: V289A
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: V289A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177437
AA Change: V158A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135809
Gene: ENSMUSG00000030067
AA Change: V158A

DomainStartEndE-ValueType
low complexity region 10 61 N/A INTRINSIC
low complexity region 70 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
FH 362 443 2.07e-39 SMART
Meta Mutation Damage Score 0.0574 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R3896:Foxp1 UTSW 6 99075936 missense probably benign 0.33
R5006:Foxp1 UTSW 6 99162858 missense probably damaging 0.98
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5428:Foxp1 UTSW 6 99016631 missense probably damaging 1.00
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7559:Foxp1 UTSW 6 98945560 missense unknown
R7715:Foxp1 UTSW 6 98945660 missense unknown
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAGGTTTCTTAGAGTCACAGG -3'
(R):5'- CACACTGGGCTTTGTTTACTGAC -3'

Sequencing Primer
(F):5'- TCACAGGACTGGGCGAG -3'
(R):5'- ATTTAATTACTGTTTGAAGAGGACGG -3'
Posted On2014-10-30