Incidental Mutation 'R2338:A1cf'
ID 246656
Institutional Source Beutler Lab
Gene Symbol A1cf
Ensembl Gene ENSMUSG00000052595
Gene Name APOBEC1 complementation factor
Synonyms apobec-1 complementation factor, ACF, 1810073H04Rik
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R2338 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 31868764-31948573 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31932545 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 330 (P330S)
Ref Sequence ENSEMBL: ENSMUSP00000153465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]
AlphaFold Q5YD48
Predicted Effect probably benign
Transcript: ENSMUST00000075838
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: P330S

DomainStartEndE-ValueType
RRM 57 130 2.13e-18 SMART
RRM 137 214 1.59e-8 SMART
RRM 232 299 1.36e-16 SMART
low complexity region 386 411 N/A INTRINSIC
Pfam:DND1_DSRM 445 523 1.6e-30 PFAM
low complexity region 526 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224304
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224400
AA Change: P246S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000224564
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in A1cf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:A1cf APN 19 31920951 missense possibly damaging 0.90
IGL01411:A1cf APN 19 31911229 missense possibly damaging 0.94
IGL01445:A1cf APN 19 31945798 missense probably benign 0.32
IGL02165:A1cf APN 19 31927186 missense possibly damaging 0.92
IGL02543:A1cf APN 19 31918095 missense probably damaging 0.97
IGL02651:A1cf APN 19 31932506 missense probably benign 0.25
IGL02904:A1cf APN 19 31934806 missense probably damaging 1.00
Haywire UTSW 19 31918124 critical splice donor site probably null
R0281:A1cf UTSW 19 31945814 missense probably benign 0.09
R0349:A1cf UTSW 19 31932662 missense possibly damaging 0.62
R0662:A1cf UTSW 19 31920938 missense probably benign 0.00
R0697:A1cf UTSW 19 31911167 missense probably damaging 1.00
R1055:A1cf UTSW 19 31932519 missense probably benign 0.05
R1125:A1cf UTSW 19 31920978 missense probably benign 0.00
R1448:A1cf UTSW 19 31908796 missense possibly damaging 0.88
R1554:A1cf UTSW 19 31908902 missense possibly damaging 0.66
R1616:A1cf UTSW 19 31934775 missense probably damaging 0.98
R1660:A1cf UTSW 19 31893107 nonsense probably null
R1719:A1cf UTSW 19 31927126 missense probably damaging 1.00
R2435:A1cf UTSW 19 31920894 missense probably benign 0.02
R2890:A1cf UTSW 19 31918017 missense probably benign 0.05
R3688:A1cf UTSW 19 31911169 missense probably damaging 1.00
R4007:A1cf UTSW 19 31918124 critical splice donor site probably null
R4208:A1cf UTSW 19 31932660 missense probably benign 0.00
R4448:A1cf UTSW 19 31945862 missense probably benign
R5072:A1cf UTSW 19 31917985 missense probably benign 0.18
R5491:A1cf UTSW 19 31918062 missense possibly damaging 0.57
R5636:A1cf UTSW 19 31944982 nonsense probably null
R5932:A1cf UTSW 19 31893118 missense possibly damaging 0.68
R7066:A1cf UTSW 19 31927114 missense probably damaging 0.99
R7211:A1cf UTSW 19 31927141 missense probably benign 0.23
R7413:A1cf UTSW 19 31918124 critical splice donor site probably null
R7545:A1cf UTSW 19 31934790 missense possibly damaging 0.80
R8020:A1cf UTSW 19 31893194 missense probably benign 0.01
R8344:A1cf UTSW 19 31911119 missense possibly damaging 0.77
R8497:A1cf UTSW 19 31945850 missense probably benign
R8989:A1cf UTSW 19 31927156 missense possibly damaging 0.56
R9327:A1cf UTSW 19 31918099 missense probably benign 0.12
R9436:A1cf UTSW 19 31932575 missense probably benign
Z1176:A1cf UTSW 19 31918017 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTGATACAGAAGCATGGGC -3'
(R):5'- ACAAGAACTAGCTAGTGTTACCTCTG -3'

Sequencing Primer
(F):5'- TGGTAGACCAAGACTTGTCGG -3'
(R):5'- GCTAGTGTTACCTCTGACAGAAG -3'
Posted On 2014-10-30