Mutagenetix > Incidental Mutation

Incidental Mutation 'R2338:A1cf'

246656

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

040324-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R2338 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31932545 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 330 (P330S)

Ref Sequence

ENSEMBL: ENSMUSP00000153465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304] [ENSMUST00000224400] [ENSMUST00000224564]

AlphaFold

Q5YD48

Predicted Effect

probably benign
Transcript: ENSMUST00000075838
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: P330S

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224304
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000224400
AA Change: P246S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000224564
AA Change: P330S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.5%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	A	G	14: 36,095,152	D53G	probably benign	Het
4931440F15Rik	C	A	11: 29,823,718	A580S	probably benign	Het
A830010M20Rik	T	C	5: 107,510,574	L1158S	probably damaging	Het
Acta2	A	G	19: 34,248,541		probably benign	Het
Actrt3	A	G	3: 30,597,836	*370R	probably null	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Cadps2	C	G	6: 23,838,978		probably benign	Het
Camsap3	C	T	8: 3,606,808	R1048C	probably damaging	Het
Cdkl2	C	T	5: 92,033,679	A148T	possibly damaging	Het
Dab2	T	A	15: 6,435,252	I395K	possibly damaging	Het
Dclk2	A	G	3: 86,799,017	F589S	probably damaging	Het
Ddx60	T	C	8: 62,012,436	S1376P	possibly damaging	Het
Eprs	T	C	1: 185,415,808	F1256L	probably damaging	Het
Etaa1	A	T	11: 17,945,605		probably null	Het
Fat2	T	C	11: 55,311,901	T116A	possibly damaging	Het
Fmnl3	T	C	15: 99,370,227	T26A	probably benign	Het
Foxp1	A	G	6: 99,003,293	V158A	possibly damaging	Het
G6pd2	T	A	5: 61,810,008	D375E	probably benign	Het
Gne	C	T	4: 44,042,196	A460T	probably damaging	Het
Gprin1	T	A	13: 54,738,425		probably null	Het
Hecw2	T	C	1: 53,904,422	M949V	possibly damaging	Het
Herc1	G	A	9: 66,428,969	V1599M	possibly damaging	Het
Hk2	A	C	6: 82,731,115	N628K	probably damaging	Het
Hmcn1	T	C	1: 150,622,934	T4065A	possibly damaging	Het
Ipo8	T	A	6: 148,789,823	Q683L	probably benign	Het
Krt81	A	G	15: 101,463,336	I121T	probably benign	Het
Lamb2	T	C	9: 108,482,141	L322P	probably benign	Het
Lilrb4a	A	G	10: 51,491,700	M113V	probably benign	Het
Mnat1	G	A	12: 73,219,143		probably null	Het
Mucl1	T	A	15: 103,753,698	T68S	possibly damaging	Het
Npnt	G	T	3: 132,891,409	D461E	probably damaging	Het
Nrp1	A	T	8: 128,497,904	Q716L	probably benign	Het
Olfr358	T	G	2: 37,005,147	S156R	probably damaging	Het
Olfr623	A	T	7: 103,660,410	I280N	possibly damaging	Het
Olfr741	A	G	14: 50,485,640	T61A	possibly damaging	Het
Podxl2	T	C	6: 88,849,196	Q376R	probably damaging	Het
Pudp	T	C	18: 50,568,575	D29G	probably benign	Het
Rrs1	C	A	1: 9,545,801		probably null	Het
S1pr3	T	C	13: 51,419,578	I265T	possibly damaging	Het
Scgb1b2	A	T	7: 31,291,613	C23*	probably null	Het
Spag8	G	T	4: 43,652,826	R212S	probably benign	Het
Tacc2	A	G	7: 130,733,569		probably null	Het
Trmt1l	C	T	1: 151,428,959		probably benign	Het
Trpa1	A	T	1: 14,884,245	L810Q	probably damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Ugt3a1	T	A	15: 9,291,973		probably benign	Het
Vmn2r23	T	G	6: 123,704,425	I97M	possibly damaging	Het
Vmn2r65	A	T	7: 84,940,843	F622I	possibly damaging	Het
Vps13a	C	T	19: 16,720,453	G766E	probably damaging	Het
Wnk1	T	C	6: 119,969,534	T553A	probably benign	Het
Xirp2	T	A	2: 67,510,770	D1118E	probably damaging	Het
Zfyve9	A	C	4: 108,660,614	D461E	probably damaging	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0281:A1cf	UTSW	19	31945814	missense	probably benign	0.09
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- ACTGATACAGAAGCATGGGC -3'
(R):5'- ACAAGAACTAGCTAGTGTTACCTCTG -3'

Sequencing Primer
(F):5'- TGGTAGACCAAGACTTGTCGG -3'
(R):5'- GCTAGTGTTACCTCTGACAGAAG -3'

Posted On

2014-10-30