Incidental Mutation 'R2339:Upf2'
List |< first << previous [record 28 of 30] next >> last >|
ID246660
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 6040102 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect probably benign
Transcript: ENSMUST00000060092
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128200
SMART Domains Protein: ENSMUSP00000119348
Gene: ENSMUSG00000043241

DomainStartEndE-ValueType
MIF4G 27 240 3.43e-50 SMART
low complexity region 279 298 N/A INTRINSIC
Pfam:Upf2 304 469 3.1e-44 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0390:Upf2 UTSW 2 6018894 unclassified probably benign
R0480:Upf2 UTSW 2 5957634 missense possibly damaging 0.71
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R5630:Upf2 UTSW 2 6027301 missense probably damaging 0.99
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7371:Upf2 UTSW 2 5961040 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
R7439:Upf2 UTSW 2 6018932 missense unknown
R7441:Upf2 UTSW 2 6018932 missense unknown
R7461:Upf2 UTSW 2 5973536 missense unknown
R7483:Upf2 UTSW 2 6027408 missense unknown
R7613:Upf2 UTSW 2 5973536 missense unknown
R7976:Upf2 UTSW 2 6026115 missense unknown
R8044:Upf2 UTSW 2 6029438 missense unknown
R8516:Upf2 UTSW 2 6018971 missense unknown
Z1176:Upf2 UTSW 2 6023388 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGCTTTATGTGCTGTCTGAC -3'
(R):5'- AACTCAAAGGAGGTTCCCAAG -3'

Sequencing Primer
(F):5'- ACCTGTGGTTAGTATTTAGCTCC -3'
(R):5'- CTCAAAGGAGGTTCCCAAGAAAGC -3'
Posted On2014-10-30