Incidental Mutation 'R2339:Trdmt1'
List |< first << previous [record 25 of 30] next >> last >|
ID246661
Institutional Source Beutler Lab
Gene Symbol Trdmt1
Ensembl Gene ENSMUSG00000026723
Gene NametRNA aspartic acid methyltransferase 1
SynonymsRnmt2, Dnmt2
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location13509014-13544668 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 13520060 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 195 (Q195*)
Ref Sequence ENSEMBL: ENSMUSP00000114572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124488] [ENSMUST00000144957]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000028055
Predicted Effect probably null
Transcript: ENSMUST00000124488
AA Change: Q195*
SMART Domains Protein: ENSMUSP00000114572
Gene: ENSMUSG00000026723
AA Change: Q195*

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 391 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144957
SMART Domains Protein: ENSMUSP00000141758
Gene: ENSMUSG00000026723

DomainStartEndE-ValueType
Pfam:DNA_methylase 4 84 4.7e-13 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a decreased proportion of natural killer cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Trdmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Trdmt1 APN 2 13521260 splice site probably null
IGL01584:Trdmt1 APN 2 13519928 missense probably benign 0.00
IGL02491:Trdmt1 APN 2 13516672 missense probably benign 0.17
IGL03025:Trdmt1 APN 2 13523435 missense probably damaging 0.98
R0167:Trdmt1 UTSW 2 13516018 missense probably damaging 1.00
R0193:Trdmt1 UTSW 2 13544617 missense probably damaging 1.00
R0638:Trdmt1 UTSW 2 13516648 splice site probably benign
R0690:Trdmt1 UTSW 2 13544580 missense probably benign 0.01
R0735:Trdmt1 UTSW 2 13523438 missense probably benign 0.23
R1102:Trdmt1 UTSW 2 13523414 splice site probably benign
R1432:Trdmt1 UTSW 2 13519846 missense probably damaging 0.98
R1610:Trdmt1 UTSW 2 13516059 missense probably damaging 1.00
R1935:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R1936:Trdmt1 UTSW 2 13511609 missense probably damaging 1.00
R2060:Trdmt1 UTSW 2 13519914 missense probably benign 0.01
R2231:Trdmt1 UTSW 2 13525625 missense probably damaging 1.00
R3703:Trdmt1 UTSW 2 13521297 missense probably benign 0.16
R3735:Trdmt1 UTSW 2 13519873 missense possibly damaging 0.51
R4751:Trdmt1 UTSW 2 13544653 utr 5 prime probably benign
R6258:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6260:Trdmt1 UTSW 2 13520059 missense probably benign 0.01
R6799:Trdmt1 UTSW 2 13516013 critical splice donor site probably null
R7329:Trdmt1 UTSW 2 13516122 missense probably damaging 1.00
R8126:Trdmt1 UTSW 2 13520005 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TTTCAGCATCTGCACAGAGAGG -3'
(R):5'- GACTGGATGACTGCTAGCTTC -3'

Sequencing Primer
(F):5'- ATCTGCACAGAGAGGTCACTGTC -3'
(R):5'- GACTGCTAGCTTCTGACAATAAC -3'
Posted On2014-10-30