Incidental Mutation 'R2339:Sox12'
List |< first << previous [record 23 of 30] next >> last >|
ID246664
Institutional Source Beutler Lab
Gene Symbol Sox12
Ensembl Gene ENSMUSG00000051817
Gene NameSRY (sex determining region Y)-box 12
Synonyms2010205A02Rik
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2339 (G1)
Quality Score166
Status Validated
Chromosome2
Chromosomal Location152393611-152398063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152397038 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 221 (S221P)
Ref Sequence ENSEMBL: ENSMUSP00000138293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063332] [ENSMUST00000182625]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063332
AA Change: S221P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064250
Gene: ENSMUSG00000051817
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
HMG 39 109 1.39e-29 SMART
low complexity region 110 182 N/A INTRINSIC
low complexity region 191 217 N/A INTRINSIC
low complexity region 221 250 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182625
AA Change: S221P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000138293
Gene: ENSMUSG00000051817
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
HMG 39 109 1.39e-29 SMART
low complexity region 110 182 N/A INTRINSIC
low complexity region 191 217 N/A INTRINSIC
low complexity region 221 250 N/A INTRINSIC
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SOX family of transcription factors are characterized by the presence of a DNA-binding high mobility group (HMG) domain, homologous to the HMG box of sex-determining region Y (SRY). Forming a subgroup of the HMG domain superfamily, SOX proteins have been implicated in cell fate decisions in a diverse range of developmental processes. SOX transcription factors have diverse tissue-specific expression patterns during early development and have been proposed to act as target-specific transcription factors and/or as chromatin structure regulatory elements. The protein encoded by this gene was identified as a SOX family member based on conserved domains, and its expression in various tissues suggests a role in both differentiation and maintenance of several cell types. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit no phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Sox12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2417:Sox12 UTSW 2 152396797 missense possibly damaging 0.85
R5177:Sox12 UTSW 2 152397178 missense unknown
R5929:Sox12 UTSW 2 152397388 missense probably damaging 0.98
R6751:Sox12 UTSW 2 152396758 missense probably damaging 0.99
R7337:Sox12 UTSW 2 152397457 missense probably damaging 0.98
R8319:Sox12 UTSW 2 152397272 missense unknown
Z1088:Sox12 UTSW 2 152397465 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATTCGAAATGTGACGTGCC -3'
(R):5'- GGACTACCCGGACTACAAGTAC -3'

Sequencing Primer
(F):5'- ATGTGACGTGCCCGAAG -3'
(R):5'- TGGCAGTCGGCTGAAAC -3'
Posted On2014-10-30