Incidental Mutation 'R2339:Pakap'
ID246666
Institutional Source Beutler Lab
Gene Symbol Pakap
Ensembl Gene ENSMUSG00000089945
Gene Nameparalemmin A kinase anchor protein
SynonymsPalm2Akap2, AF064781, Palm2-Akap2, Gm20459
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location57568179-57896982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 57883180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 882 (R882H)
Ref Sequence ENSEMBL: ENSMUSP00000103226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043456] [ENSMUST00000098064] [ENSMUST00000098066] [ENSMUST00000102902] [ENSMUST00000102903] [ENSMUST00000107598] [ENSMUST00000107600]
Predicted Effect probably damaging
Transcript: ENSMUST00000043456
AA Change: R841H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048678
Gene: ENSMUSG00000038729
AA Change: R841H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 568 885 2.5e-17 PFAM
Pfam:RII_binding_1 585 602 1.6e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098064
AA Change: R841H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095672
Gene: ENSMUSG00000038729
AA Change: R841H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102902
SMART Domains Protein: ENSMUSP00000099966
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102903
SMART Domains Protein: ENSMUSP00000099967
Gene: ENSMUSG00000038729

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:RII_binding_1 585 602 3.5e-5 PFAM
coiled coil region 730 766 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107598
AA Change: R841H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103224
Gene: ENSMUSG00000038729
AA Change: R841H

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
coiled coil region 256 314 N/A INTRINSIC
Pfam:AKAP2_C 569 872 4e-13 PFAM
Pfam:RII_binding_1 585 602 2.9e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107600
AA Change: R882H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103226
Gene: ENSMUSG00000038729
AA Change: R882H

DomainStartEndE-ValueType
low complexity region 193 204 N/A INTRINSIC
low complexity region 254 268 N/A INTRINSIC
coiled coil region 297 355 N/A INTRINSIC
Pfam:AKAP2_C 636 913 2.8e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000150412
AA Change: R1084H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945
AA Change: R1084H

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Meta Mutation Damage Score 0.2679 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Palm2 (paralemmin 2) and Akap2 (A kinase (PRKA) anchor protein 2) genes on chromosome 4. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. Similar readthrough transcription has also been observed in human, as described in PMID: 11478809. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Pakap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pakap APN 4 57757627 nonsense probably null
IGL01371:Pakap APN 4 57856325 missense probably benign 0.03
IGL01647:Pakap APN 4 57688477 missense possibly damaging 0.82
IGL01733:Pakap APN 4 57856488 missense probably benign 0.01
IGL02677:Pakap APN 4 57856263 missense probably benign 0.01
IGL02696:Pakap APN 4 57854663 missense probably damaging 0.97
IGL03067:Pakap APN 4 57648038 missense probably benign 0.02
IGL03343:Pakap APN 4 57688502 missense probably damaging 1.00
R1913:Pakap UTSW 4 57892963 missense probably damaging 1.00
R5442:Pakap UTSW 4 57637876 missense probably null
Predicted Primers PCR Primer
(F):5'- CCTTCTACAAGCAGTGCCTG -3'
(R):5'- TAGTCCCCGAGGCACATTAAAC -3'

Sequencing Primer
(F):5'- CAGATGAGCTTAGAAAGGGTGTTCTC -3'
(R):5'- GAGGCACATTAAACCACTCATTTG -3'
Posted On2014-10-30