Incidental Mutation 'R2339:Hacd4'
ID246667
Institutional Source Beutler Lab
Gene Symbol Hacd4
Ensembl Gene ENSMUSG00000028497
Gene Name3-hydroxyacyl-CoA dehydratase 4
Synonyms4933428I03Rik, Ptplad2
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location88396144-88438928 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 88423099 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030221] [ENSMUST00000030221] [ENSMUST00000132493] [ENSMUST00000132493]
Predicted Effect probably null
Transcript: ENSMUST00000030221
SMART Domains Protein: ENSMUSP00000030221
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTPLA 65 226 3.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030221
SMART Domains Protein: ENSMUSP00000030221
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:PTPLA 65 226 3.4e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132493
SMART Domains Protein: ENSMUSP00000119411
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 80 234 1.5e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000132493
SMART Domains Protein: ENSMUSP00000119411
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:PTPLA 80 234 1.5e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151280
SMART Domains Protein: ENSMUSP00000122565
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:PTPLA 85 244 3e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151280
SMART Domains Protein: ENSMUSP00000122565
Gene: ENSMUSG00000028497

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
Pfam:PTPLA 85 244 3e-37 PFAM
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Hacd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Hacd4 APN 4 88423048 missense probably damaging 0.98
PIT4260001:Hacd4 UTSW 4 88398105 missense unknown
PIT4260001:Hacd4 UTSW 4 88398106 nonsense probably null
R0597:Hacd4 UTSW 4 88437520 missense probably damaging 1.00
R0625:Hacd4 UTSW 4 88435010 missense probably benign 0.04
R1054:Hacd4 UTSW 4 88423027 missense probably damaging 0.96
R1069:Hacd4 UTSW 4 88437502 missense probably damaging 0.99
R1478:Hacd4 UTSW 4 88423023 missense probably damaging 1.00
R1944:Hacd4 UTSW 4 88423066 missense possibly damaging 0.73
R3177:Hacd4 UTSW 4 88437510 missense probably damaging 1.00
R3277:Hacd4 UTSW 4 88437510 missense probably damaging 1.00
R3902:Hacd4 UTSW 4 88437501 missense probably damaging 1.00
R4429:Hacd4 UTSW 4 88434947 missense possibly damaging 0.50
R5834:Hacd4 UTSW 4 88398152 missense probably benign 0.00
R6242:Hacd4 UTSW 4 88414287 missense probably benign
R7252:Hacd4 UTSW 4 88426763 missense possibly damaging 0.73
R7508:Hacd4 UTSW 4 88437478 missense probably benign 0.06
R7857:Hacd4 UTSW 4 88437465 missense probably damaging 1.00
X0004:Hacd4 UTSW 4 88423008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACCCCACTGAACTTTGC -3'
(R):5'- GGTTTCCTCCTGCAACAATAC -3'

Sequencing Primer
(F):5'- CTGGGAAAGTTAACATCAATAAGCC -3'
(R):5'- AATACACCATTTTAACCCCTGTCC -3'
Posted On2014-10-30