Incidental Mutation 'R2339:Pparg'
List |< first << previous [record 18 of 30] next >> last >|
ID246672
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Nameperoxisome proliferator activated receptor gamma
SynonymsPpar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115360951-115490399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115451044 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 164 (R164L)
Ref Sequence ENSEMBL: ENSMUSP00000144975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732] [ENSMUST00000205213]
Predicted Effect probably damaging
Transcript: ENSMUST00000000450
AA Change: R194L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: R194L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171644
AA Change: R164L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203732
AA Change: R164L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204889
Predicted Effect probably damaging
Transcript: ENSMUST00000205213
AA Change: R164L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: R164L

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Meta Mutation Damage Score 0.9633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R4946:Pparg UTSW 6 115451028 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
R8103:Pparg UTSW 6 115473141 missense possibly damaging 0.91
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCACTTTTGCTGATGTCCAAG -3'
(R):5'- ACACGAAGAAGCTCTCATCAGG -3'

Sequencing Primer
(F):5'- CTGATGTCCAAGTCAATGAGTGTC -3'
(R):5'- GAAGCTCTCATCAGGATGACTTTG -3'
Posted On2014-10-30