Incidental Mutation 'R2339:Cilp2'
List |< first << previous [record 2 of 30] next >> last >|
ID246675
Institutional Source Beutler Lab
Gene Symbol Cilp2
Ensembl Gene ENSMUSG00000044006
Gene Namecartilage intermediate layer protein 2
Synonyms1110031K21Rik, CLIP-2
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2339 (G1)
Quality Score183
Status Validated
Chromosome8
Chromosomal Location69880369-69887687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69882894 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 485 (S485T)
Ref Sequence ENSEMBL: ENSMUSP00000061544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831] [ENSMUST00000152938] [ENSMUST00000180068]
Predicted Effect probably benign
Transcript: ENSMUST00000057831
AA Change: S485T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006
AA Change: S485T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152456
Predicted Effect probably benign
Transcript: ENSMUST00000152938
SMART Domains Protein: ENSMUSP00000118931
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:YjeF_N 17 187 5.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180068
SMART Domains Protein: ENSMUSP00000136145
Gene: ENSMUSG00000048967

DomainStartEndE-ValueType
Pfam:YjeF_N 2 159 8.8e-24 PFAM
Meta Mutation Damage Score 0.0627 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Cilp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Cilp2 APN 8 69882846 missense probably damaging 0.96
IGL01538:Cilp2 APN 8 69881204 missense probably benign 0.13
IGL02063:Cilp2 APN 8 69882865 missense probably damaging 1.00
IGL02582:Cilp2 APN 8 69881286 missense probably damaging 1.00
IGL02892:Cilp2 APN 8 69884320 missense probably benign 0.02
R0308:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0371:Cilp2 UTSW 8 69881606 missense probably damaging 1.00
R0413:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0414:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0470:Cilp2 UTSW 8 69885405 missense possibly damaging 0.87
R0838:Cilp2 UTSW 8 69881719 missense probably benign 0.04
R0842:Cilp2 UTSW 8 69883118 missense probably damaging 1.00
R1807:Cilp2 UTSW 8 69882194 missense probably damaging 1.00
R1864:Cilp2 UTSW 8 69881323 missense probably damaging 1.00
R2010:Cilp2 UTSW 8 69881694 missense probably damaging 1.00
R2104:Cilp2 UTSW 8 69882792 nonsense probably null
R4572:Cilp2 UTSW 8 69882410 missense probably damaging 1.00
R5225:Cilp2 UTSW 8 69883365 missense probably damaging 1.00
R5923:Cilp2 UTSW 8 69882875 missense probably damaging 1.00
R6113:Cilp2 UTSW 8 69882359 missense probably benign 0.00
R6958:Cilp2 UTSW 8 69882540 missense probably benign 0.01
R7108:Cilp2 UTSW 8 69881129 missense probably damaging 1.00
R7454:Cilp2 UTSW 8 69883390 missense probably damaging 1.00
R7455:Cilp2 UTSW 8 69881071 missense probably damaging 1.00
R7598:Cilp2 UTSW 8 69886032 missense probably benign 0.29
R7736:Cilp2 UTSW 8 69881421 missense probably damaging 1.00
R7781:Cilp2 UTSW 8 69882347 missense possibly damaging 0.81
Z1088:Cilp2 UTSW 8 69885410 missense possibly damaging 0.94
Z1177:Cilp2 UTSW 8 69882808 missense probably damaging 0.99
Z1177:Cilp2 UTSW 8 69884542 missense probably damaging 1.00
Z1177:Cilp2 UTSW 8 69884546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGAAAGTGACACGAGCCTC -3'
(R):5'- CTGATCAAGCTTCCGGACGATTG -3'

Sequencing Primer
(F):5'- GCGTCCAACAGCACTGC -3'
(R):5'- ACGTACCTAGACGTGGGTC -3'
Posted On2014-10-30