Incidental Mutation 'R2339:Fyn'
ID246676
Institutional Source Beutler Lab
Gene Symbol Fyn
Ensembl Gene ENSMUSG00000019843
Gene NameFyn proto-oncogene
SynonymsSrc Kinase p59
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location39368855-39565381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39522785 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 126 (T126A)
Ref Sequence ENSEMBL: ENSMUSP00000114188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063091] [ENSMUST00000099967] [ENSMUST00000126486] [ENSMUST00000135242] [ENSMUST00000136659] [ENSMUST00000146287]
Predicted Effect probably benign
Transcript: ENSMUST00000063091
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057707
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099967
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097547
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 1.65e-33 SMART
TyrKc 271 520 1.08e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126486
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115233
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135242
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117111
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136659
AA Change: T126A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118131
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 4.37e-33 SMART
TyrKc 222 465 7.5e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146287
AA Change: T126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000114188
Gene: ENSMUSG00000019843
AA Change: T126A

DomainStartEndE-ValueType
SH3 85 142 4.21e-24 SMART
SH2 147 237 3.86e-34 SMART
TyrKc 268 517 8.07e-133 SMART
Meta Mutation Damage Score 0.0694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protein-tyrosine kinase oncogene family. It encodes a membrane-associated tyrosine kinase that has been implicated in the control of cell growth. The protein associates with the p85 subunit of phosphatidylinositol 3-kinase and interacts with the fyn-binding protein. Alternatively spliced transcript variants encoding distinct isoforms exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: Different targeted allele homozygotes show different defects, including seizure susceptibility, anxiety, impaired suckling, myelination, LTP and spatial learning, and defects in immune system, circadian rhythm, testes weight and olfactory bulb formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Fyn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01988:Fyn APN 10 39533921 nonsense probably null
IGL02626:Fyn APN 10 39526802 missense probably damaging 1.00
H8562:Fyn UTSW 10 39511954 missense probably benign 0.00
R0128:Fyn UTSW 10 39511982 missense probably benign 0.00
R0130:Fyn UTSW 10 39511982 missense probably benign 0.00
R0336:Fyn UTSW 10 39526901 missense possibly damaging 0.52
R1446:Fyn UTSW 10 39522779 missense probably benign 0.43
R1498:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R1539:Fyn UTSW 10 39532070 missense possibly damaging 0.94
R1912:Fyn UTSW 10 39526832 missense possibly damaging 0.94
R2198:Fyn UTSW 10 39529545 missense probably benign 0.13
R3107:Fyn UTSW 10 39551455 missense probably damaging 1.00
R3109:Fyn UTSW 10 39551455 missense probably damaging 1.00
R5068:Fyn UTSW 10 39526843 missense probably damaging 1.00
R5233:Fyn UTSW 10 39529940 missense probably benign
R5929:Fyn UTSW 10 39551461 missense probably damaging 1.00
R6360:Fyn UTSW 10 39526883 missense possibly damaging 0.83
R6379:Fyn UTSW 10 39455074 start gained probably benign
R6490:Fyn UTSW 10 39551402 missense probably damaging 1.00
R7179:Fyn UTSW 10 39532124 missense possibly damaging 0.90
R8087:Fyn UTSW 10 39529557 nonsense probably null
R8246:Fyn UTSW 10 39529529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAAGTTTCCGTTTCAGGATCTC -3'
(R):5'- ACTGGGAAAGGTCTTCTCGC -3'

Sequencing Primer
(F):5'- ATTGAACCTAGAGCCTCGTG -3'
(R):5'- GGAAAGGTCTTCTCGCTCCTG -3'
Posted On2014-10-30