Incidental Mutation 'R2339:Ric8b'
ID246679
Institutional Source Beutler Lab
Gene Symbol Ric8b
Ensembl Gene ENSMUSG00000035620
Gene NameRIC8 guanine nucleotide exchange factor B
SynonymsRic-8b, Ric-8
MMRRC Submission 040325-MU
Accession Numbers

Genbank: NM_001013441, NM_183172; MGI: 2682307

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location84917616-85018337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84970024 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 333 (V333A)
Ref Sequence ENSEMBL: ENSMUSP00000093032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038523] [ENSMUST00000095385] [ENSMUST00000214693]
Predicted Effect probably benign
Transcript: ENSMUST00000038523
AA Change: V333A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046981
Gene: ENSMUSG00000035620
AA Change: V333A

DomainStartEndE-ValueType
Pfam:Ric8 66 538 8.1e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095385
AA Change: V333A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093032
Gene: ENSMUSG00000035620
AA Change: V333A

DomainStartEndE-ValueType
Pfam:Ric8 66 486 1.2e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214693
AA Change: V130A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217175
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI

All alleles(24) : Targeted, other(4) Gene trapped(20)

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Ric8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02254:Ric8b APN 10 84980136 missense probably damaging 1.00
IGL02388:Ric8b APN 10 84992271 unclassified probably benign
IGL02435:Ric8b APN 10 84980076 missense probably benign 0.06
IGL02890:Ric8b APN 10 85001867 missense possibly damaging 0.80
IGL03163:Ric8b APN 10 85001822 missense probably damaging 1.00
IGL03211:Ric8b APN 10 85001793 missense probably damaging 1.00
D4216:Ric8b UTSW 10 85015141 missense probably damaging 0.99
R0491:Ric8b UTSW 10 84992222 missense probably damaging 1.00
R0612:Ric8b UTSW 10 85001881 missense probably damaging 1.00
R1077:Ric8b UTSW 10 84970717 splice site probably benign
R1448:Ric8b UTSW 10 84947671 missense possibly damaging 0.93
R1565:Ric8b UTSW 10 84980099 missense probably benign 0.01
R1617:Ric8b UTSW 10 84947611 missense probably damaging 0.98
R1634:Ric8b UTSW 10 84970748 missense probably damaging 1.00
R1983:Ric8b UTSW 10 85001838 missense probably damaging 0.99
R2897:Ric8b UTSW 10 84947897 missense probably benign 0.01
R2898:Ric8b UTSW 10 84947897 missense probably benign 0.01
R4657:Ric8b UTSW 10 84992137 missense probably damaging 1.00
R4747:Ric8b UTSW 10 84917764 missense probably benign 0.36
R4953:Ric8b UTSW 10 84958082 missense possibly damaging 0.92
R5277:Ric8b UTSW 10 84947652 missense probably damaging 0.99
R5308:Ric8b UTSW 10 84947747 missense probably benign
R5326:Ric8b UTSW 10 84992212 missense probably damaging 1.00
R6248:Ric8b UTSW 10 84947845 missense probably damaging 1.00
R6782:Ric8b UTSW 10 84947527 missense probably damaging 1.00
R7548:Ric8b UTSW 10 84947872 missense probably damaging 1.00
R8123:Ric8b UTSW 10 84969873 missense probably damaging 1.00
Z1176:Ric8b UTSW 10 84947544 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTCCTAAAAGTCACCTCTGAACTTTG -3'
(R):5'- TAGCATGCCAAGCACCAAGG -3'

Sequencing Primer
(F):5'- ACCTCTGAACTTTGTATTATGTTTGC -3'
(R):5'- CACCAAGGACAAGCTGTGCG -3'
Posted On2014-10-30