Incidental Mutation 'R2339:Ppp4r3b'
List |< first << previous [record 19 of 30] next >> last >|
ID246681
Institutional Source Beutler Lab
Gene Symbol Ppp4r3b
Ensembl Gene ENSMUSG00000020463
Gene Nameprotein phosphatase 4 regulatory subunit 3B
SynonymsSmek2
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29172890-29220797 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29200725 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 464 (N464Y)
Ref Sequence ENSEMBL: ENSMUSP00000099920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020755] [ENSMUST00000102856] [ENSMUST00000127621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020755
AA Change: N464Y

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020755
Gene: ENSMUSG00000020463
AA Change: N464Y

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-24 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 168 359 3.6e-84 PFAM
low complexity region 511 519 N/A INTRINSIC
low complexity region 800 809 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102856
AA Change: N464Y

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099920
Gene: ENSMUSG00000020463
AA Change: N464Y

DomainStartEndE-ValueType
SCOP:d1k5db_ 7 96 2e-25 SMART
low complexity region 116 127 N/A INTRINSIC
Pfam:SMK-1 166 359 3.8e-87 PFAM
low complexity region 511 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127621
AA Change: N57Y

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000117918
Gene: ENSMUSG00000020463
AA Change: N57Y

DomainStartEndE-ValueType
low complexity region 90 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139283
Meta Mutation Damage Score 0.2138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Ppp4r3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ppp4r3b APN 11 29211782 missense possibly damaging 0.64
IGL00593:Ppp4r3b APN 11 29197205 missense possibly damaging 0.88
IGL01109:Ppp4r3b APN 11 29188288 missense probably damaging 0.97
IGL01311:Ppp4r3b APN 11 29194591 missense probably benign
IGL01397:Ppp4r3b APN 11 29213594 missense probably benign 0.05
IGL01546:Ppp4r3b APN 11 29209488 splice site probably null
IGL02588:Ppp4r3b APN 11 29198853 nonsense probably null
IGL02713:Ppp4r3b APN 11 29188445 missense probably damaging 0.98
IGL02717:Ppp4r3b APN 11 29173315 missense probably benign 0.01
PIT1430001:Ppp4r3b UTSW 11 29209434 missense probably benign 0.04
PIT4677001:Ppp4r3b UTSW 11 29187978 missense probably benign
R0766:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1170:Ppp4r3b UTSW 11 29209426 missense probably damaging 0.99
R1312:Ppp4r3b UTSW 11 29173358 missense probably benign 0.16
R1511:Ppp4r3b UTSW 11 29182460 missense probably damaging 1.00
R1692:Ppp4r3b UTSW 11 29188123 missense probably benign 0.02
R1699:Ppp4r3b UTSW 11 29213765 missense possibly damaging 0.52
R2303:Ppp4r3b UTSW 11 29200741 missense possibly damaging 0.79
R4378:Ppp4r3b UTSW 11 29209450 missense possibly damaging 0.72
R4940:Ppp4r3b UTSW 11 29211740 missense probably benign
R5256:Ppp4r3b UTSW 11 29188293 missense probably benign 0.22
R5266:Ppp4r3b UTSW 11 29173309 missense possibly damaging 0.63
R5286:Ppp4r3b UTSW 11 29211667 missense probably benign
R5354:Ppp4r3b UTSW 11 29211646 missense probably benign 0.26
R5877:Ppp4r3b UTSW 11 29209356 missense probably damaging 1.00
R6364:Ppp4r3b UTSW 11 29188035 missense probably benign 0.00
R6539:Ppp4r3b UTSW 11 29218503 missense probably benign 0.00
R6773:Ppp4r3b UTSW 11 29205639 missense probably benign 0.02
R6931:Ppp4r3b UTSW 11 29211786 missense possibly damaging 0.88
R7051:Ppp4r3b UTSW 11 29182507 missense probably damaging 1.00
R7176:Ppp4r3b UTSW 11 29198904 missense probably damaging 1.00
R7569:Ppp4r3b UTSW 11 29188540 missense possibly damaging 0.91
R7741:Ppp4r3b UTSW 11 29205701 missense possibly damaging 0.78
R7746:Ppp4r3b UTSW 11 29173352 missense probably benign 0.00
R7810:Ppp4r3b UTSW 11 29188086 missense probably benign 0.02
R8129:Ppp4r3b UTSW 11 29209364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAGTCCCCAGTGCATTG -3'
(R):5'- GGACAACCATGACTTCATAATGCAC -3'

Sequencing Primer
(F):5'- AAGTCCCCAGTGCATTGCTATTAG -3'
(R):5'- GAGAACTTACCTTTCTCGCA -3'
Posted On2014-10-30