Incidental Mutation 'R2339:Aatf'
ID246682
Institutional Source Beutler Lab
Gene Symbol Aatf
Ensembl Gene ENSMUSG00000018697
Gene Nameapoptosis antagonizing transcription factor
SynonymsTrb, 4933415H02Rik, 5830465M17Rik, Che-1
MMRRC Submission 040325-MU
Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84422855-84513522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84511497 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 121 (D121G)
Ref Sequence ENSEMBL: ENSMUSP00000018841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018841]
Predicted Effect probably benign
Transcript: ENSMUST00000018841
AA Change: D121G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: D121G

DomainStartEndE-ValueType
low complexity region 2 35 N/A INTRINSIC
low complexity region 91 119 N/A INTRINSIC
low complexity region 130 173 N/A INTRINSIC
Pfam:AATF-Che1 187 339 4.6e-40 PFAM
low complexity region 418 429 N/A INTRINSIC
Pfam:TRAUB 430 514 3.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148434
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]
Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18

Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Aatf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Aatf APN 11 84470557 splice site probably benign
IGL01482:Aatf APN 11 84470710 missense possibly damaging 0.51
IGL01775:Aatf APN 11 84471137 missense probably damaging 1.00
IGL02881:Aatf APN 11 84471289 splice site probably benign
R0183:Aatf UTSW 11 84510425 splice site probably null
R0200:Aatf UTSW 11 84445676 missense probably damaging 1.00
R0257:Aatf UTSW 11 84510281 missense probably benign 0.33
R0324:Aatf UTSW 11 84512139 critical splice donor site probably null
R0494:Aatf UTSW 11 84511513 missense probably benign
R0544:Aatf UTSW 11 84423005 missense probably benign 0.09
R1186:Aatf UTSW 11 84470549 splice site probably benign
R4626:Aatf UTSW 11 84422958 makesense probably null
R4647:Aatf UTSW 11 84471197 missense possibly damaging 0.69
R4697:Aatf UTSW 11 84449138 missense probably damaging 1.00
R4981:Aatf UTSW 11 84511497 missense probably benign 0.00
R5490:Aatf UTSW 11 84510273 missense probably damaging 1.00
R5938:Aatf UTSW 11 84442574 missense possibly damaging 0.88
R6267:Aatf UTSW 11 84473100 missense probably benign 0.09
R6296:Aatf UTSW 11 84473100 missense probably benign 0.09
R6633:Aatf UTSW 11 84511482 critical splice donor site probably null
R7081:Aatf UTSW 11 84471125 missense possibly damaging 0.84
R7212:Aatf UTSW 11 84449180 missense probably damaging 0.98
R7545:Aatf UTSW 11 84470676 missense probably benign 0.04
R7754:Aatf UTSW 11 84511509 missense possibly damaging 0.53
R7871:Aatf UTSW 11 84471038 frame shift probably null
R8411:Aatf UTSW 11 84470676 missense probably benign 0.04
X0018:Aatf UTSW 11 84510385 missense possibly damaging 0.85
Z1176:Aatf UTSW 11 84442585 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTTGGTAACCTCGAGTGTTAGG -3'
(R):5'- CGTGCAGTTGAATAGAGCAC -3'

Sequencing Primer
(F):5'- ACCTCGAGTGTTAGGTTTCTG -3'
(R):5'- GTTCTGTCATATAAGCTCCCACAG -3'
Posted On2014-10-30