Incidental Mutation 'R2339:Hist1h1e'
ID246684
Institutional Source Beutler Lab
Gene Symbol Hist1h1e
Ensembl Gene ENSMUSG00000051627
Gene Namehistone cluster 1, H1e
SynonymsH1-4, H1var2, H1s-4, H1f4, H1e
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2339 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23620629-23622558 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23621960 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000089296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000062045] [ENSMUST00000091704]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect unknown
Transcript: ENSMUST00000062045
AA Change: K180E
SMART Domains Protein: ENSMUSP00000057308
Gene: ENSMUSG00000051627
AA Change: K180E

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
H15 34 99 7.5e-23 SMART
low complexity region 116 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129312
Meta Mutation Damage Score 0.0939 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations are normal, but Hist1h1e/Hist1h1c double knockout males are significantly smaller than normal. The Hist1h1e/Hist1h1d/Hist1h1e triple knockout is lethal by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Hist1h1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hist1h1e APN 13 23622022 unclassified probably benign
IGL03354:Hist1h1e APN 13 23622077 unclassified probably benign
PIT4469001:Hist1h1e UTSW 13 23622379 missense probably damaging 1.00
R3110:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3112:Hist1h1e UTSW 13 23621846 unclassified probably benign
R3757:Hist1h1e UTSW 13 23622257 nonsense probably null
R3758:Hist1h1e UTSW 13 23622257 nonsense probably null
R5116:Hist1h1e UTSW 13 23622287 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R6034:Hist1h1e UTSW 13 23622313 missense probably damaging 1.00
R7008:Hist1h1e UTSW 13 23622209 missense probably damaging 1.00
R7051:Hist1h1e UTSW 13 23622439 missense probably benign 0.00
R7317:Hist1h1e UTSW 13 23622367 missense probably damaging 1.00
R8220:Hist1h1e UTSW 13 23621939 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCTGTGAATGTGCAACAGCTC -3'
(R):5'- CTCAACAAGAAGGCGGCTTC -3'

Sequencing Primer
(F):5'- GTGCAACAGCTCTTTTACTGAGAG -3'
(R):5'- GCTTCCGGTGAGGCTAAG -3'
Posted On2014-10-30