Incidental Mutation 'R2339:Ttc3'
List |< first << previous [record 27 of 30] next >> last >|
ID246687
Institutional Source Beutler Lab
Gene Symbol Ttc3
Ensembl Gene ENSMUSG00000040785
Gene Nametetratricopeptide repeat domain 3
Synonyms2610202A04Rik, D16Ium21, D16Ium21e, TPRD
MMRRC Submission 040325-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.649) question?
Stock #R2339 (G1)
Quality Score215
Status Validated
Chromosome16
Chromosomal Location94370618-94469343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94431998 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1003 (P1003L)
Ref Sequence ENSEMBL: ENSMUSP00000122724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000155692] [ENSMUST00000232395] [ENSMUST00000231569] [ENSMUST00000232660] [ENSMUST00000231915] [ENSMUST00000231850]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101881
Predicted Effect probably damaging
Transcript: ENSMUST00000117648
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: P984L

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122895
AA Change: P966L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: P966L

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141176
AA Change: P182L
SMART Domains Protein: ENSMUSP00000114483
Gene: ENSMUSG00000040785
AA Change: P182L

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
coiled coil region 72 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000147352
AA Change: P966L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: P966L

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150346
AA Change: P583L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785
AA Change: P583L

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000151770
AA Change: P984L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: P984L

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152117
AA Change: P583L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785
AA Change: P583L

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155692
AA Change: P1003L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: P1003L

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000232395
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231569
AA Change: P629L

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000232660
AA Change: P984L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231915
Predicted Effect probably benign
Transcript: ENSMUST00000231850
Meta Mutation Damage Score 0.4526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,511,497 D121G probably benign Het
Cilp2 A T 8: 69,882,894 S485T probably benign Het
Cux1 A C 5: 136,287,008 S1059R probably damaging Het
Dnah5 A G 15: 28,313,882 D1948G probably benign Het
Fyn A G 10: 39,522,785 T126A probably benign Het
Gm10134 C T 2: 28,506,129 S12F probably benign Het
Gm8251 G T 1: 44,060,863 D358E probably benign Het
Grm7 T C 6: 111,495,681 I827T possibly damaging Het
Hacd4 T A 4: 88,423,099 probably null Het
Helt T C 8: 46,292,672 N58S probably damaging Het
Hist1h1e T C 13: 23,621,960 probably benign Het
Jakmip1 T C 5: 37,091,199 Y68H probably benign Het
Myof G T 19: 37,937,927 H1127N probably damaging Het
Nbas A T 12: 13,362,592 I971L probably benign Het
Olfr1285 C T 2: 111,409,189 T258I probably benign Het
Pakap G A 4: 57,883,180 R882H probably damaging Het
Peg10 A G 6: 4,756,102 probably benign Het
Pparg G T 6: 115,451,044 R164L probably damaging Het
Ppp4r3b A T 11: 29,200,725 N464Y possibly damaging Het
Ric8b T C 10: 84,970,024 V333A probably benign Het
Sall2 G A 14: 52,313,356 S792L probably damaging Het
Slc5a4b C A 10: 76,108,549 L87F probably damaging Het
Sox12 A G 2: 152,397,038 S221P possibly damaging Het
Tpr T A 1: 150,413,774 S619T probably benign Het
Trdmt1 G A 2: 13,520,060 Q195* probably null Het
Trpm2 A T 10: 77,914,806 probably benign Het
Upf2 A T 2: 6,040,102 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp318 C T 17: 46,399,463 T704I probably benign Het
Other mutations in Ttc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ttc3 APN 16 94426761 splice site probably null
IGL00979:Ttc3 APN 16 94456718 missense probably damaging 1.00
IGL01520:Ttc3 APN 16 94390207 missense probably benign 0.04
IGL01663:Ttc3 APN 16 94409731 critical splice donor site probably null
IGL01720:Ttc3 APN 16 94385369 missense probably damaging 0.99
IGL01736:Ttc3 APN 16 94442527 missense probably damaging 0.99
IGL02045:Ttc3 APN 16 94409681 splice site probably benign
IGL02203:Ttc3 APN 16 94418598 splice site probably benign
IGL02327:Ttc3 APN 16 94448108 missense probably damaging 1.00
IGL02794:Ttc3 APN 16 94467926 missense probably damaging 1.00
IGL02898:Ttc3 APN 16 94419426 missense probably damaging 1.00
PIT4378001:Ttc3 UTSW 16 94410906 missense probably benign 0.01
R0064:Ttc3 UTSW 16 94422247 missense possibly damaging 0.79
R0098:Ttc3 UTSW 16 94390265 missense probably benign 0.02
R0112:Ttc3 UTSW 16 94385322 splice site probably benign
R0135:Ttc3 UTSW 16 94462268 missense possibly damaging 0.92
R0480:Ttc3 UTSW 16 94432004 nonsense probably null
R0513:Ttc3 UTSW 16 94426212 missense probably damaging 1.00
R0532:Ttc3 UTSW 16 94387330 splice site probably benign
R0607:Ttc3 UTSW 16 94456785 nonsense probably null
R0742:Ttc3 UTSW 16 94459880 missense probably benign 0.23
R0905:Ttc3 UTSW 16 94456789 nonsense probably null
R1118:Ttc3 UTSW 16 94416268 splice site probably benign
R1355:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1370:Ttc3 UTSW 16 94418637 missense possibly damaging 0.46
R1486:Ttc3 UTSW 16 94448129 missense probably damaging 1.00
R1598:Ttc3 UTSW 16 94422297 missense probably damaging 1.00
R1641:Ttc3 UTSW 16 94443317 missense probably benign 0.19
R2092:Ttc3 UTSW 16 94442832 missense probably benign 0.02
R2232:Ttc3 UTSW 16 94459972 missense probably benign 0.00
R2342:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R2842:Ttc3 UTSW 16 94431998 missense probably damaging 1.00
R3117:Ttc3 UTSW 16 94442563 missense possibly damaging 0.51
R4194:Ttc3 UTSW 16 94422277 missense probably damaging 0.99
R4329:Ttc3 UTSW 16 94466961 missense probably damaging 1.00
R4431:Ttc3 UTSW 16 94410958 critical splice donor site probably null
R4530:Ttc3 UTSW 16 94466877 intron probably benign
R4531:Ttc3 UTSW 16 94466877 intron probably benign
R4532:Ttc3 UTSW 16 94466877 intron probably benign
R4533:Ttc3 UTSW 16 94466877 intron probably benign
R4588:Ttc3 UTSW 16 94442901 missense probably benign 0.01
R4625:Ttc3 UTSW 16 94388272 nonsense probably null
R4676:Ttc3 UTSW 16 94442761 missense probably damaging 1.00
R4700:Ttc3 UTSW 16 94439241 splice site probably null
R4856:Ttc3 UTSW 16 94390283 missense probably benign 0.32
R4867:Ttc3 UTSW 16 94454515 missense probably damaging 0.96
R4885:Ttc3 UTSW 16 94419465 missense probably damaging 1.00
R4885:Ttc3 UTSW 16 94426831 critical splice donor site probably null
R4899:Ttc3 UTSW 16 94429455 missense probably damaging 1.00
R4997:Ttc3 UTSW 16 94452982 missense probably damaging 1.00
R5023:Ttc3 UTSW 16 94429359 missense probably benign 0.01
R5105:Ttc3 UTSW 16 94466934 missense possibly damaging 0.94
R5205:Ttc3 UTSW 16 94448059 missense probably benign 0.07
R5287:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5338:Ttc3 UTSW 16 94384041 missense probably damaging 0.99
R5347:Ttc3 UTSW 16 94429620 missense probably damaging 1.00
R5403:Ttc3 UTSW 16 94459844 missense probably benign 0.00
R5460:Ttc3 UTSW 16 94457382 missense probably benign 0.32
R5739:Ttc3 UTSW 16 94439324 nonsense probably null
R6242:Ttc3 UTSW 16 94442695 missense probably benign 0.04
R6253:Ttc3 UTSW 16 94457413 critical splice donor site probably null
R6455:Ttc3 UTSW 16 94418623 start codon destroyed probably null 0.83
R6559:Ttc3 UTSW 16 94422349 critical splice donor site probably null
R6564:Ttc3 UTSW 16 94442611 missense probably damaging 1.00
R6932:Ttc3 UTSW 16 94443453 missense probably benign
R7331:Ttc3 UTSW 16 94394359 missense probably benign 0.27
R7497:Ttc3 UTSW 16 94418682 missense possibly damaging 0.93
R7610:Ttc3 UTSW 16 94427838 missense probably benign 0.11
R7738:Ttc3 UTSW 16 94387382 missense probably benign 0.00
R7970:Ttc3 UTSW 16 94457364 missense probably damaging 1.00
R8052:Ttc3 UTSW 16 94467989 missense probably benign 0.09
R8087:Ttc3 UTSW 16 94442953 missense probably benign 0.00
R8309:Ttc3 UTSW 16 94466979 missense probably damaging 1.00
R8320:Ttc3 UTSW 16 94418676 missense probably damaging 1.00
R8322:Ttc3 UTSW 16 94454492 missense probably damaging 1.00
R8518:Ttc3 UTSW 16 94457379 missense probably benign 0.21
X0022:Ttc3 UTSW 16 94442525 missense probably benign 0.00
Y5378:Ttc3 UTSW 16 94412129 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACGGAGCATCTCTCAAGGAG -3'
(R):5'- AGGCTGGGACCTTTCTTTCAAG -3'

Sequencing Primer
(F):5'- CAAGGAGCTTGATTTCCACG -3'
(R):5'- TTCTTCACCTCTGATCATCAAAAGAC -3'
Posted On2014-10-30