Incidental Mutation 'R2340:Sned1'
ID246693
Institutional Source Beutler Lab
Gene Symbol Sned1
Ensembl Gene ENSMUSG00000047793
Gene Namesushi, nidogen and EGF-like domains 1
Synonyms6720455I24Rik, D430044C15Rik, Snep
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93235841-93301065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 93256452 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 134 (I134N)
Ref Sequence ENSEMBL: ENSMUSP00000050832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062202]
Predicted Effect probably damaging
Transcript: ENSMUST00000062202
AA Change: I134N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: I134N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
NIDO 103 260 2.98e-54 SMART
EGF 271 309 3.79e-6 SMART
EGF_CA 311 347 2.42e-13 SMART
EGF 352 385 1.02e-6 SMART
EGF_CA 387 423 1.91e-11 SMART
EGF 432 465 2.96e-8 SMART
EGF 471 500 6.02e0 SMART
EGF 544 577 3.54e-6 SMART
EGF 583 616 6.06e-5 SMART
EGF_CA 619 655 2.33e-6 SMART
EGF 660 693 1.77e-6 SMART
CCP 698 751 2.5e-11 SMART
EGF_CA 753 789 1.66e-11 SMART
EGF_CA 791 827 1.38e-8 SMART
EGF_CA 829 865 1.92e-7 SMART
EGF 870 903 2.35e-2 SMART
FN3 906 991 1.7e-4 SMART
FN3 1005 1084 1.38e-4 SMART
FN3 1104 1185 1.6e-9 SMART
EGF 1309 1342 6.16e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172289
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Sned1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Sned1 APN 1 93274169 splice site probably benign
IGL00955:Sned1 APN 1 93274403 missense probably damaging 1.00
IGL01367:Sned1 APN 1 93283214 missense probably benign 0.32
IGL02116:Sned1 APN 1 93281725 nonsense probably null
IGL02195:Sned1 APN 1 93274160 missense probably benign 0.03
IGL02390:Sned1 APN 1 93261664 missense probably benign
IGL02423:Sned1 APN 1 93283600 missense probably benign
IGL02451:Sned1 APN 1 93236208 splice site probably benign
IGL02567:Sned1 APN 1 93274347 missense probably damaging 0.96
IGL03184:Sned1 APN 1 93274668 missense probably benign 0.01
IGL03328:Sned1 APN 1 93289367 missense probably benign
R0257:Sned1 UTSW 1 93265097 missense possibly damaging 0.75
R0372:Sned1 UTSW 1 93285951 splice site probably benign
R0525:Sned1 UTSW 1 93271974 splice site probably null
R0727:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0759:Sned1 UTSW 1 93272564 missense probably damaging 1.00
R0965:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0968:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R0969:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1006:Sned1 UTSW 1 93256392 missense probably damaging 1.00
R1068:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1069:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1070:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1112:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1113:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1114:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1115:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1118:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1119:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1144:Sned1 UTSW 1 93280576 missense probably damaging 0.98
R1228:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1230:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1231:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1313:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1340:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1382:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1383:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1394:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1395:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1397:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1414:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1430:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1432:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1473:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1503:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1563:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1565:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1689:Sned1 UTSW 1 93283372 missense probably damaging 0.99
R1695:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1734:Sned1 UTSW 1 93259768 missense probably damaging 1.00
R1764:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1767:Sned1 UTSW 1 93281654 missense possibly damaging 0.89
R1896:Sned1 UTSW 1 93265047 missense probably benign 0.16
R1916:Sned1 UTSW 1 93274162 missense probably null 1.00
R1945:Sned1 UTSW 1 93271238 missense probably benign 0.01
R1972:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R1973:Sned1 UTSW 1 93265073 missense probably damaging 1.00
R2143:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2144:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2145:Sned1 UTSW 1 93271684 missense probably damaging 1.00
R2153:Sned1 UTSW 1 93274657 missense probably benign 0.01
R2273:Sned1 UTSW 1 93281642 splice site probably null
R2274:Sned1 UTSW 1 93281642 splice site probably null
R2275:Sned1 UTSW 1 93281642 splice site probably null
R3237:Sned1 UTSW 1 93259003 missense probably benign 0.21
R3747:Sned1 UTSW 1 93261751 missense probably damaging 1.00
R3879:Sned1 UTSW 1 93265030 splice site probably benign
R4281:Sned1 UTSW 1 93285855 nonsense probably null
R4282:Sned1 UTSW 1 93285855 nonsense probably null
R4356:Sned1 UTSW 1 93265391 splice site probably null
R4358:Sned1 UTSW 1 93274659 missense probably benign 0.01
R4677:Sned1 UTSW 1 93296297 unclassified probably benign
R5291:Sned1 UTSW 1 93295724 missense possibly damaging 0.80
R5340:Sned1 UTSW 1 93282757 missense probably benign 0.09
R5542:Sned1 UTSW 1 93271602 missense probably benign
R5582:Sned1 UTSW 1 93282361 missense probably damaging 1.00
R5874:Sned1 UTSW 1 93265345 missense probably damaging 1.00
R6159:Sned1 UTSW 1 93282937 missense probably benign 0.00
R6175:Sned1 UTSW 1 93275474 splice site probably null
R6445:Sned1 UTSW 1 93283596 missense possibly damaging 0.89
R6631:Sned1 UTSW 1 93281652 missense probably damaging 1.00
R7018:Sned1 UTSW 1 93284421 missense probably damaging 1.00
R7035:Sned1 UTSW 1 93262130 missense probably damaging 1.00
R7047:Sned1 UTSW 1 93285818 missense possibly damaging 0.51
R7347:Sned1 UTSW 1 93281736 missense probably damaging 1.00
R7427:Sned1 UTSW 1 93289358 missense probably benign 0.11
R7581:Sned1 UTSW 1 93256545 missense probably benign 0.00
R7679:Sned1 UTSW 1 93236038 missense unknown
X0025:Sned1 UTSW 1 93261687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCATCTCCTTCCTGAAG -3'
(R):5'- TGATTTCAGAAGTGCCAGGAGC -3'

Sequencing Primer
(F):5'- GAAGGAAGTTTCTCAGTTCACCC -3'
(R):5'- TGTAGGCCACCTGTACCTG -3'
Posted On2014-10-30