Mutagenetix > Incidental Mutations

Incidental Mutation 'R2340:Sned1'

246693

Institutional Source

Beutler Lab

Gene Symbol

Sned1

Ensembl Gene

ENSMUSG00000047793

Gene Name

sushi, nidogen and EGF-like domains 1

Synonyms

6720455I24Rik, D430044C15Rik, Snep

MMRRC Submission

040326-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R2340 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93235841-93301065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 93256452 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 134 (I134N)

Ref Sequence

ENSEMBL: ENSMUSP00000050832 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062202]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062202
AA Change: I134N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000050832
Gene: ENSMUSG00000047793
AA Change: I134N

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
NIDO	103	260	2.98e-54	SMART
EGF	271	309	3.79e-6	SMART
EGF_CA	311	347	2.42e-13	SMART
EGF	352	385	1.02e-6	SMART
EGF_CA	387	423	1.91e-11	SMART
EGF	432	465	2.96e-8	SMART
EGF	471	500	6.02e0	SMART
EGF	544	577	3.54e-6	SMART
EGF	583	616	6.06e-5	SMART
EGF_CA	619	655	2.33e-6	SMART
EGF	660	693	1.77e-6	SMART
CCP	698	751	2.5e-11	SMART
EGF_CA	753	789	1.66e-11	SMART
EGF_CA	791	827	1.38e-8	SMART
EGF_CA	829	865	1.92e-7	SMART
EGF	870	903	2.35e-2	SMART
FN3	906	991	1.7e-4	SMART
FN3	1005	1084	1.38e-4	SMART
FN3	1104	1185	1.6e-9	SMART
EGF	1309	1342	6.16e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172289

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (37/38)

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
Abca13	A	T	11: 9,399,165	I3580F	probably damaging	Het
B3glct	A	G	5: 149,745,440	K280E	probably benign	Het
Chd6	TG	T	2: 160,965,759		probably null	Het
Clu	T	C	14: 65,980,909	V406A	probably damaging	Het
D930020B18Rik	A	G	10: 121,654,836	K114E	probably damaging	Het
Dsg1c	T	A	18: 20,267,888	D149E	probably damaging	Het
Fam189a1	A	G	7: 64,775,817	S176P	probably benign	Het
Fat2	A	T	11: 55,270,096	D3269E	possibly damaging	Het
Frmd4a	A	G	2: 4,586,376	D69G	probably damaging	Het
Hacd1	G	T	2: 14,035,887	P186T	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Kif2c	A	G	4: 117,169,841	V320A	probably damaging	Het
Lypd2	T	A	15: 74,734,254	I12L	probably benign	Het
Midn	G	T	10: 80,150,112	R12L	possibly damaging	Het
Olfr11	T	C	13: 21,638,587	K312R	probably benign	Het
Olfr1497	A	G	19: 13,794,771	V280A	probably benign	Het
Olfr954	A	G	9: 39,461,809	Y126C	probably damaging	Het
Pkhd1	A	T	1: 20,200,855	V3158E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rad51d	T	C	11: 82,881,821	D206G	probably damaging	Het
Rcan1	A	G	16: 92,397,352	F58L	probably damaging	Het
Rnf145	T	C	11: 44,531,378	I96T	probably benign	Het
Rnf216	A	T	5: 143,080,334	F500I	probably damaging	Het
Rph3al	T	C	11: 75,833,432	T282A	probably benign	Het
Serpina11	T	C	12: 103,984,743	R240G	probably benign	Het
Slc12a2	T	A	18: 57,900,050	I400N	probably benign	Het
Slco1a4	C	A	6: 141,841,377	C28F	probably benign	Het
Spock3	T	A	8: 63,345,713	M253K	probably damaging	Het
Tmem184b	T	A	15: 79,378,532	M42L	probably benign	Het
Tnnt1	G	A	7: 4,513,616		probably benign	Het
Ttll5	T	A	12: 85,892,148	S407T	probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfat	T	C	15: 68,101,541	E1117G	probably damaging	Het
Zfp606	A	G	7: 12,493,089	E321G	possibly damaging	Het

Other mutations in Sned1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00785:Sned1	APN	1	93274169	splice site	probably benign
IGL00955:Sned1	APN	1	93274403	missense	probably damaging	1.00
IGL01367:Sned1	APN	1	93283214	missense	probably benign	0.32
IGL02116:Sned1	APN	1	93281725	nonsense	probably null
IGL02195:Sned1	APN	1	93274160	missense	probably benign	0.03
IGL02390:Sned1	APN	1	93261664	missense	probably benign
IGL02423:Sned1	APN	1	93283600	missense	probably benign
IGL02451:Sned1	APN	1	93236208	splice site	probably benign
IGL02567:Sned1	APN	1	93274347	missense	probably damaging	0.96
IGL03184:Sned1	APN	1	93274668	missense	probably benign	0.01
IGL03328:Sned1	APN	1	93289367	missense	probably benign
R0257:Sned1	UTSW	1	93265097	missense	possibly damaging	0.75
R0372:Sned1	UTSW	1	93285951	splice site	probably benign
R0525:Sned1	UTSW	1	93271974	splice site	probably null
R0727:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0759:Sned1	UTSW	1	93272564	missense	probably damaging	1.00
R0965:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0968:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R0969:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1006:Sned1	UTSW	1	93256392	missense	probably damaging	1.00
R1068:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1069:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1070:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1112:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1113:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1114:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1115:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1118:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1119:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1144:Sned1	UTSW	1	93280576	missense	probably damaging	0.98
R1228:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1230:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1231:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1313:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1340:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1382:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1383:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1394:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1395:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1397:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1414:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1430:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1432:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1473:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1503:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1563:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1565:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1689:Sned1	UTSW	1	93283372	missense	probably damaging	0.99
R1695:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1734:Sned1	UTSW	1	93259768	missense	probably damaging	1.00
R1764:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1767:Sned1	UTSW	1	93281654	missense	possibly damaging	0.89
R1896:Sned1	UTSW	1	93265047	missense	probably benign	0.16
R1916:Sned1	UTSW	1	93274162	missense	probably null	1.00
R1945:Sned1	UTSW	1	93271238	missense	probably benign	0.01
R1972:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R1973:Sned1	UTSW	1	93265073	missense	probably damaging	1.00
R2143:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2144:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2145:Sned1	UTSW	1	93271684	missense	probably damaging	1.00
R2153:Sned1	UTSW	1	93274657	missense	probably benign	0.01
R2273:Sned1	UTSW	1	93281642	splice site	probably null
R2274:Sned1	UTSW	1	93281642	splice site	probably null
R2275:Sned1	UTSW	1	93281642	splice site	probably null
R3237:Sned1	UTSW	1	93259003	missense	probably benign	0.21
R3747:Sned1	UTSW	1	93261751	missense	probably damaging	1.00
R3879:Sned1	UTSW	1	93265030	splice site	probably benign
R4281:Sned1	UTSW	1	93285855	nonsense	probably null
R4282:Sned1	UTSW	1	93285855	nonsense	probably null
R4356:Sned1	UTSW	1	93265391	splice site	probably null
R4358:Sned1	UTSW	1	93274659	missense	probably benign	0.01
R4677:Sned1	UTSW	1	93296297	unclassified	probably benign
R5291:Sned1	UTSW	1	93295724	missense	possibly damaging	0.80
R5340:Sned1	UTSW	1	93282757	missense	probably benign	0.09
R5542:Sned1	UTSW	1	93271602	missense	probably benign
R5582:Sned1	UTSW	1	93282361	missense	probably damaging	1.00
R5874:Sned1	UTSW	1	93265345	missense	probably damaging	1.00
R6159:Sned1	UTSW	1	93282937	missense	probably benign	0.00
R6175:Sned1	UTSW	1	93275474	splice site	probably null
R6445:Sned1	UTSW	1	93283596	missense	possibly damaging	0.89
R6631:Sned1	UTSW	1	93281652	missense	probably damaging	1.00
R7018:Sned1	UTSW	1	93284421	missense	probably damaging	1.00
R7035:Sned1	UTSW	1	93262130	missense	probably damaging	1.00
R7047:Sned1	UTSW	1	93285818	missense	possibly damaging	0.51
R7347:Sned1	UTSW	1	93281736	missense	probably damaging	1.00
R7427:Sned1	UTSW	1	93289358	missense	probably benign	0.11
R7581:Sned1	UTSW	1	93256545	missense	probably benign	0.00
R7679:Sned1	UTSW	1	93236038	missense	unknown
R7899:Sned1	UTSW	1	93274082	missense	probably benign	0.04
R8093:Sned1	UTSW	1	93274665	missense	possibly damaging	0.82
R8124:Sned1	UTSW	1	93282989	critical splice donor site	probably null
R8489:Sned1	UTSW	1	93283256	nonsense	probably null
X0025:Sned1	UTSW	1	93261687	missense	probably damaging	1.00
Z1176:Sned1	UTSW	1	93259042	missense	probably damaging	1.00
Z1177:Sned1	UTSW	1	93285820	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGGATCATCTCCTTCCTGAAG -3'
(R):5'- TGATTTCAGAAGTGCCAGGAGC -3'

Sequencing Primer
(F):5'- GAAGGAAGTTTCTCAGTTCACCC -3'
(R):5'- TGTAGGCCACCTGTACCTG -3'

Posted On

2014-10-30