Incidental Mutation 'R2340:Frmd4a'
ID246696
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4586376 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000134803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: D363G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: D363G

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: D374G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: D374G

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153160
Predicted Effect possibly damaging
Transcript: ENSMUST00000175944
AA Change: D411G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657
AA Change: D411G

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176828
AA Change: D69G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: D69G

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176864
AA Change: D58G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657
AA Change: D58G

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177457
AA Change: D378G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: D378G

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.3094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7607:Frmd4a UTSW 2 4591936 nonsense probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
R7750:Frmd4a UTSW 2 4601349 missense probably benign 0.14
R7795:Frmd4a UTSW 2 4590695 missense probably damaging 1.00
R7848:Frmd4a UTSW 2 4591917 intron probably benign
R7899:Frmd4a UTSW 2 4604089 missense probably damaging 1.00
R8024:Frmd4a UTSW 2 4603702 missense probably damaging 1.00
R8399:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
Z1176:Frmd4a UTSW 2 4498021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCACTCCTCACGCTTGGAAC -3'
(R):5'- GGGAGGGACAGTACATGTTTTC -3'

Sequencing Primer
(F):5'- TCACGCTTGGAACACTGC -3'
(R):5'- GGGACAGTACATGTTTTCCTGAAAG -3'
Posted On2014-10-30