Incidental Mutation 'R2340:Kif2c'
ID246700
Institutional Source Beutler Lab
Gene Symbol Kif2c
Ensembl Gene ENSMUSG00000028678
Gene Namekinesin family member 2C
Synonyms4930402F02Rik
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117159639-117182639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117169841 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 320 (V320A)
Ref Sequence ENSEMBL: ENSMUSP00000064261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065896] [ENSMUST00000106436]
PDB Structure
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-ADP [X-RAY DIFFRACTION]
The Crystal Structure of the Minimal Functional Domain of the Microtubule Destabilizer KIF2C Complexed with Mg-AMPPNP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000065896
AA Change: V320A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064261
Gene: ENSMUSG00000028678
AA Change: V320A

DomainStartEndE-ValueType
low complexity region 192 205 N/A INTRINSIC
KISc 252 590 1.04e-131 SMART
coiled coil region 615 647 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106436
AA Change: V269A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102044
Gene: ENSMUSG00000028678
AA Change: V269A

DomainStartEndE-ValueType
low complexity region 141 154 N/A INTRINSIC
KISc 201 539 1.04e-131 SMART
coiled coil region 564 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141675
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142205
Meta Mutation Damage Score 0.6536 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kinesin-like protein that functions as a microtubule-dependent molecular motor. The encoded protein can depolymerize microtubules at the plus end, thereby promoting mitotic chromosome segregation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Kif2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Kif2c APN 4 117178246 missense probably benign 0.01
IGL01020:Kif2c APN 4 117166904 missense probably damaging 1.00
IGL01131:Kif2c APN 4 117172365 missense probably damaging 1.00
IGL02131:Kif2c APN 4 117177953 missense possibly damaging 0.88
IGL02455:Kif2c APN 4 117172354 missense probably benign
IGL02556:Kif2c APN 4 117162605 missense probably damaging 0.98
IGL03084:Kif2c APN 4 117178158 missense possibly damaging 0.67
IGL03333:Kif2c APN 4 117180636 missense possibly damaging 0.87
IGL03353:Kif2c APN 4 117166336 missense probably benign 0.19
R0025:Kif2c UTSW 4 117165517 missense probably damaging 1.00
R0466:Kif2c UTSW 4 117172292 missense possibly damaging 0.83
R1069:Kif2c UTSW 4 117178153 missense probably damaging 0.97
R1519:Kif2c UTSW 4 117169940 missense probably damaging 1.00
R1594:Kif2c UTSW 4 117178188 missense probably benign 0.02
R1789:Kif2c UTSW 4 117167361 missense probably benign 0.18
R1894:Kif2c UTSW 4 117162223 missense probably benign 0.02
R2830:Kif2c UTSW 4 117182448 splice site probably null
R3734:Kif2c UTSW 4 117162646 missense probably benign 0.02
R4634:Kif2c UTSW 4 117178240 missense probably benign 0.04
R4720:Kif2c UTSW 4 117171749 missense probably benign
R4908:Kif2c UTSW 4 117166411 missense probably damaging 1.00
R5076:Kif2c UTSW 4 117174869 unclassified probably benign
R5855:Kif2c UTSW 4 117182542 unclassified probably benign
R6766:Kif2c UTSW 4 117167083 missense probably benign
R6767:Kif2c UTSW 4 117178188 missense probably benign 0.00
R6942:Kif2c UTSW 4 117166378 missense probably damaging 1.00
R7378:Kif2c UTSW 4 117162029 missense possibly damaging 0.46
R7526:Kif2c UTSW 4 117182432 missense possibly damaging 0.46
R7797:Kif2c UTSW 4 117171743 missense probably benign 0.00
R8087:Kif2c UTSW 4 117165418 missense possibly damaging 0.92
U24488:Kif2c UTSW 4 117182442 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTAAGGCTGGGCTGCTATAG -3'
(R):5'- GAGCAGCCCCTGAAATCTTC -3'

Sequencing Primer
(F):5'- GTGACATGGCAGGTCCCAAAC -3'
(R):5'- GAAATCTTCTCCTTCTGCAGAACTGG -3'
Posted On2014-10-30