Incidental Mutation 'R2340:Ttll5'
ID246720
Institutional Source Beutler Lab
Gene Symbol Ttll5
Ensembl Gene ENSMUSG00000012609
Gene Nametubulin tyrosine ligase-like family, member 5
SynonymsSTAMP
MMRRC Submission 040326-MU
Accession Numbers

Genbank: NM_001081423

Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location85824659-86061893 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85892148 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 407 (S407T)
Ref Sequence ENSEMBL: ENSMUSP00000093192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]
Predicted Effect probably benign
Transcript: ENSMUST00000040179
AA Change: S407T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 1.9e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040273
AA Change: S407T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 556 575 N/A INTRINSIC
low complexity region 595 621 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 1167 1181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095536
AA Change: S407T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110224
AA Change: S407T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 1e-94 PFAM
low complexity region 543 562 N/A INTRINSIC
low complexity region 582 608 N/A INTRINSIC
low complexity region 734 748 N/A INTRINSIC
low complexity region 768 780 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155448
AA Change: S407T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 6.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175899
Predicted Effect probably benign
Transcript: ENSMUST00000176695
AA Change: S407T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177114
AA Change: S407T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: S407T

DomainStartEndE-ValueType
Pfam:TTL 110 407 2.1e-95 PFAM
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Ttll5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Ttll5 APN 12 85843826 missense probably damaging 1.00
IGL00932:Ttll5 APN 12 85929907 missense probably damaging 1.00
IGL00964:Ttll5 APN 12 85849283 missense possibly damaging 0.78
IGL00978:Ttll5 APN 12 85933482 nonsense probably null
IGL00990:Ttll5 APN 12 85876589 missense probably damaging 1.00
IGL01726:Ttll5 APN 12 85918934 missense probably benign 0.30
IGL01797:Ttll5 APN 12 85956597 missense possibly damaging 0.54
IGL02008:Ttll5 APN 12 85933611 missense probably damaging 1.00
IGL02210:Ttll5 APN 12 85912545 intron probably benign
IGL02979:Ttll5 APN 12 85826582 missense probably damaging 1.00
IGL03079:Ttll5 APN 12 85876558 missense probably damaging 1.00
IGL03149:Ttll5 APN 12 85918984 missense probably damaging 0.98
G4846:Ttll5 UTSW 12 86024244 missense probably damaging 0.99
PIT4812001:Ttll5 UTSW 12 85926861 missense probably benign 0.12
R0045:Ttll5 UTSW 12 85879359 splice site probably benign
R0153:Ttll5 UTSW 12 85831966 missense probably damaging 1.00
R0282:Ttll5 UTSW 12 85996053 missense probably benign 0.12
R0318:Ttll5 UTSW 12 85876594 critical splice donor site probably null
R0465:Ttll5 UTSW 12 85933326 missense probably benign 0.42
R0540:Ttll5 UTSW 12 85933676 critical splice donor site probably null
R1086:Ttll5 UTSW 12 85891079 missense possibly damaging 0.66
R1467:Ttll5 UTSW 12 85918962 splice site probably null
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1470:Ttll5 UTSW 12 85879394 missense possibly damaging 0.59
R1505:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R1524:Ttll5 UTSW 12 85864568 nonsense probably null
R1540:Ttll5 UTSW 12 85892208 nonsense probably null
R1598:Ttll5 UTSW 12 85863598 missense probably damaging 0.98
R1649:Ttll5 UTSW 12 85923014 missense probably damaging 1.00
R1774:Ttll5 UTSW 12 85933402 missense probably benign 0.09
R4049:Ttll5 UTSW 12 86012799 missense probably benign 0.01
R4094:Ttll5 UTSW 12 85956602 nonsense probably null
R4095:Ttll5 UTSW 12 85956602 nonsense probably null
R4908:Ttll5 UTSW 12 85919174 missense probably benign 0.31
R5012:Ttll5 UTSW 12 85926844 missense possibly damaging 0.93
R5137:Ttll5 UTSW 12 85923045 missense possibly damaging 0.83
R5416:Ttll5 UTSW 12 86012828 missense possibly damaging 0.77
R5773:Ttll5 UTSW 12 85933555 frame shift probably null
R5774:Ttll5 UTSW 12 85933555 frame shift probably null
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6039:Ttll5 UTSW 12 85831955 missense probably damaging 1.00
R6173:Ttll5 UTSW 12 85933377 missense probably damaging 0.99
R6343:Ttll5 UTSW 12 85956699 missense probably benign 0.00
R6449:Ttll5 UTSW 12 86024276 missense probably benign 0.00
R6750:Ttll5 UTSW 12 85956610 missense probably damaging 0.98
R6802:Ttll5 UTSW 12 85879386 missense probably damaging 1.00
R6825:Ttll5 UTSW 12 85883328 splice site probably null
R6955:Ttll5 UTSW 12 85864579 missense possibly damaging 0.91
R7098:Ttll5 UTSW 12 85917673 critical splice acceptor site probably null
R7154:Ttll5 UTSW 12 85925764 missense probably damaging 0.98
R7215:Ttll5 UTSW 12 85933396 missense probably benign 0.02
R7339:Ttll5 UTSW 12 85857464 critical splice donor site probably null
R7520:Ttll5 UTSW 12 85899471 missense probably damaging 1.00
R7728:Ttll5 UTSW 12 85956632 missense probably benign 0.02
R7894:Ttll5 UTSW 12 85889174 missense probably damaging 1.00
R8119:Ttll5 UTSW 12 86020548 missense probably damaging 0.98
R8129:Ttll5 UTSW 12 85891084 critical splice donor site probably null
R8200:Ttll5 UTSW 12 85879410 missense probably damaging 1.00
R8357:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
R8413:Ttll5 UTSW 12 85919121 missense probably benign 0.00
R8457:Ttll5 UTSW 12 85876578 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACATCTTTGTCAATCAGAAGTAC -3'
(R):5'- TTGTTGGGAAGCAGTTGAAAGC -3'

Sequencing Primer
(F):5'- GAAGTACGTTTAGCTTCTCAGTCAG -3'
(R):5'- TGCTGCTGAACAAGTCCC -3'
Posted On2014-10-30