Mutagenetix > Incidental Mutations

Incidental Mutation 'R2340:Ttll5'

246720

Institutional Source

Beutler Lab

Gene Symbol

Ttll5

Ensembl Gene

ENSMUSG00000012609

Gene Name

tubulin tyrosine ligase-like family, member 5

Synonyms

STAMP

MMRRC Submission

040326-MU

Accession Numbers

Genbank: NM_001081423

Is this an essential gene?

Possibly essential (E-score: 0.516) question?

Stock #

R2340 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85824659-86061893 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 85892148 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 407 (S407T)

Ref Sequence

ENSEMBL: ENSMUSP00000093192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040179] [ENSMUST00000040273] [ENSMUST00000095536] [ENSMUST00000110224] [ENSMUST00000155448] [ENSMUST00000176695] [ENSMUST00000177114]

Predicted Effect

probably benign
Transcript: ENSMUST00000040179
AA Change: S407T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000048809
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1.9e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000040273
AA Change: S407T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000039939
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	556	575	N/A	INTRINSIC
low complexity region	595	621	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	781	793	N/A	INTRINSIC
low complexity region	835	847	N/A	INTRINSIC
low complexity region	1167	1181	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000095536
AA Change: S407T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000093192
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.2e-95	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110224
AA Change: S407T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105853
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	1e-94	PFAM
low complexity region	543	562	N/A	INTRINSIC
low complexity region	582	608	N/A	INTRINSIC
low complexity region	734	748	N/A	INTRINSIC
low complexity region	768	780	N/A	INTRINSIC
low complexity region	822	834	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000155448
AA Change: S407T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000134971
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	6.4e-95	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175899

Predicted Effect

probably benign
Transcript: ENSMUST00000176695
AA Change: S407T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000135852
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177114
AA Change: S407T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000135395
Gene: ENSMUSG00000012609
AA Change: S407T

Domain	Start	End	E-Value	Type
Pfam:TTL	110	407	2.1e-95	PFAM

Meta Mutation Damage Score

0.0737

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubulin tyrosine ligase like protein family. This protein interacts with two glucocorticoid receptor coactivators, transcriptional intermediary factor 2 and steroid receptor coactivator 1. This protein may function as a coregulator of glucocorticoid receptor mediated gene induction and repression. This protein may also function as an alpha tubulin polyglutamylase.[provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit male infertility associated with abnormal sperm morphology and reduced tubulin polyglutamylation in the spermatozoa. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted, other(3) Gene trapped(4)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	A	T	12: 71,164,547	E685V	possibly damaging	Het
2700049A03Rik	G	T	12: 71,164,546	E685*	probably null	Het
Abca13	A	T	11: 9,399,165	I3580F	probably damaging	Het
B3glct	A	G	5: 149,745,440	K280E	probably benign	Het
Chd6	TG	T	2: 160,965,759		probably null	Het
Clu	T	C	14: 65,980,909	V406A	probably damaging	Het
D930020B18Rik	A	G	10: 121,654,836	K114E	probably damaging	Het
Dsg1c	T	A	18: 20,267,888	D149E	probably damaging	Het
Fam189a1	A	G	7: 64,775,817	S176P	probably benign	Het
Fat2	A	T	11: 55,270,096	D3269E	possibly damaging	Het
Frmd4a	A	G	2: 4,586,376	D69G	probably damaging	Het
Hacd1	G	T	2: 14,035,887	P186T	probably damaging	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Kif2c	A	G	4: 117,169,841	V320A	probably damaging	Het
Lypd2	T	A	15: 74,734,254	I12L	probably benign	Het
Midn	G	T	10: 80,150,112	R12L	possibly damaging	Het
Olfr11	T	C	13: 21,638,587	K312R	probably benign	Het
Olfr1497	A	G	19: 13,794,771	V280A	probably benign	Het
Olfr954	A	G	9: 39,461,809	Y126C	probably damaging	Het
Pkhd1	A	T	1: 20,200,855	V3158E	probably damaging	Het
Plxna2	C	T	1: 194,749,317	S538F	probably damaging	Het
Rad51d	T	C	11: 82,881,821	D206G	probably damaging	Het
Rcan1	A	G	16: 92,397,352	F58L	probably damaging	Het
Rnf145	T	C	11: 44,531,378	I96T	probably benign	Het
Rnf216	A	T	5: 143,080,334	F500I	probably damaging	Het
Rph3al	T	C	11: 75,833,432	T282A	probably benign	Het
Serpina11	T	C	12: 103,984,743	R240G	probably benign	Het
Slc12a2	T	A	18: 57,900,050	I400N	probably benign	Het
Slco1a4	C	A	6: 141,841,377	C28F	probably benign	Het
Sned1	T	A	1: 93,256,452	I134N	probably damaging	Het
Spock3	T	A	8: 63,345,713	M253K	probably damaging	Het
Tmem184b	T	A	15: 79,378,532	M42L	probably benign	Het
Tnnt1	G	A	7: 4,513,616		probably benign	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Zfat	T	C	15: 68,101,541	E1117G	probably damaging	Het
Zfp606	A	G	7: 12,493,089	E321G	possibly damaging	Het

Other mutations in Ttll5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00844:Ttll5	APN	12	85843826	missense	probably damaging	1.00
IGL00932:Ttll5	APN	12	85929907	missense	probably damaging	1.00
IGL00964:Ttll5	APN	12	85849283	missense	possibly damaging	0.78
IGL00978:Ttll5	APN	12	85933482	nonsense	probably null
IGL00990:Ttll5	APN	12	85876589	missense	probably damaging	1.00
IGL01726:Ttll5	APN	12	85918934	missense	probably benign	0.30
IGL01797:Ttll5	APN	12	85956597	missense	possibly damaging	0.54
IGL02008:Ttll5	APN	12	85933611	missense	probably damaging	1.00
IGL02210:Ttll5	APN	12	85912545	intron	probably benign
IGL02979:Ttll5	APN	12	85826582	missense	probably damaging	1.00
IGL03079:Ttll5	APN	12	85876558	missense	probably damaging	1.00
IGL03149:Ttll5	APN	12	85918984	missense	probably damaging	0.98
G4846:Ttll5	UTSW	12	86024244	missense	probably damaging	0.99
PIT4812001:Ttll5	UTSW	12	85926861	missense	probably benign	0.12
R0045:Ttll5	UTSW	12	85879359	splice site	probably benign
R0153:Ttll5	UTSW	12	85831966	missense	probably damaging	1.00
R0282:Ttll5	UTSW	12	85996053	missense	probably benign	0.12
R0318:Ttll5	UTSW	12	85876594	critical splice donor site	probably null
R0465:Ttll5	UTSW	12	85933326	missense	probably benign	0.42
R0540:Ttll5	UTSW	12	85933676	critical splice donor site	probably null
R1086:Ttll5	UTSW	12	85891079	missense	possibly damaging	0.66
R1467:Ttll5	UTSW	12	85918962	splice site	probably null
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1470:Ttll5	UTSW	12	85879394	missense	possibly damaging	0.59
R1505:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R1524:Ttll5	UTSW	12	85864568	nonsense	probably null
R1540:Ttll5	UTSW	12	85892208	nonsense	probably null
R1598:Ttll5	UTSW	12	85863598	missense	probably damaging	0.98
R1649:Ttll5	UTSW	12	85923014	missense	probably damaging	1.00
R1774:Ttll5	UTSW	12	85933402	missense	probably benign	0.09
R4049:Ttll5	UTSW	12	86012799	missense	probably benign	0.01
R4094:Ttll5	UTSW	12	85956602	nonsense	probably null
R4095:Ttll5	UTSW	12	85956602	nonsense	probably null
R4908:Ttll5	UTSW	12	85919174	missense	probably benign	0.31
R5012:Ttll5	UTSW	12	85926844	missense	possibly damaging	0.93
R5137:Ttll5	UTSW	12	85923045	missense	possibly damaging	0.83
R5416:Ttll5	UTSW	12	86012828	missense	possibly damaging	0.77
R5773:Ttll5	UTSW	12	85933555	frame shift	probably null
R5774:Ttll5	UTSW	12	85933555	frame shift	probably null
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6039:Ttll5	UTSW	12	85831955	missense	probably damaging	1.00
R6173:Ttll5	UTSW	12	85933377	missense	probably damaging	0.99
R6343:Ttll5	UTSW	12	85956699	missense	probably benign	0.00
R6449:Ttll5	UTSW	12	86024276	missense	probably benign	0.00
R6750:Ttll5	UTSW	12	85956610	missense	probably damaging	0.98
R6802:Ttll5	UTSW	12	85879386	missense	probably damaging	1.00
R6825:Ttll5	UTSW	12	85883328	splice site	probably null
R6955:Ttll5	UTSW	12	85864579	missense	possibly damaging	0.91
R7098:Ttll5	UTSW	12	85917673	critical splice acceptor site	probably null
R7154:Ttll5	UTSW	12	85925764	missense	probably damaging	0.98
R7215:Ttll5	UTSW	12	85933396	missense	probably benign	0.02
R7339:Ttll5	UTSW	12	85857464	critical splice donor site	probably null
R7520:Ttll5	UTSW	12	85899471	missense	probably damaging	1.00
R7728:Ttll5	UTSW	12	85956632	missense	probably benign	0.02
R7894:Ttll5	UTSW	12	85889174	missense	probably damaging	1.00
R8119:Ttll5	UTSW	12	86020548	missense	probably damaging	0.98
R8129:Ttll5	UTSW	12	85891084	critical splice donor site	probably null
R8200:Ttll5	UTSW	12	85879410	missense	probably damaging	1.00
R8357:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00
R8413:Ttll5	UTSW	12	85919121	missense	probably benign	0.00
R8457:Ttll5	UTSW	12	85876578	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACATCTTTGTCAATCAGAAGTAC -3'
(R):5'- TTGTTGGGAAGCAGTTGAAAGC -3'

Sequencing Primer
(F):5'- GAAGTACGTTTAGCTTCTCAGTCAG -3'
(R):5'- TGCTGCTGAACAAGTCCC -3'

Posted On

2014-10-30