Incidental Mutation 'R2340:Zfat'
ID246725
Institutional Source Beutler Lab
Gene Symbol Zfat
Ensembl Gene ENSMUSG00000022335
Gene Namezinc finger and AT hook domain containing
SynonymsLOC380993, Zfat1, Zfp406
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location68083764-68258856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68101541 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1117 (E1117G)
Ref Sequence ENSEMBL: ENSMUSP00000125732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]
PDB Structure
Solution structure of the 5th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Solution structure of the 8th C2H2 zinc finger of mouse Zinc finger protein 406 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000160248
AA Change: E1135G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: E1135G

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1073 1082 N/A INTRINSIC
low complexity region 1139 1149 N/A INTRINSIC
low complexity region 1218 1236 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162054
AA Change: E1117G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: E1117G

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 213 229 N/A INTRINSIC
ZnF_C2H2 264 286 1.47e-3 SMART
ZnF_C2H2 292 314 1.18e-2 SMART
ZnF_C2H2 319 342 2.36e-2 SMART
ZnF_C2H2 347 370 4.4e-2 SMART
ZnF_C2H2 397 419 1.67e-2 SMART
ZnF_C2H2 425 447 1.33e-1 SMART
ZnF_C2H2 451 474 2.05e-2 SMART
low complexity region 594 610 N/A INTRINSIC
ZnF_C2H2 730 752 1.43e-1 SMART
ZnF_C2H2 758 781 3.52e-1 SMART
ZnF_C2H2 786 810 5.59e-4 SMART
ZnF_C2H2 818 841 3.83e-2 SMART
ZnF_C2H2 868 891 3.95e1 SMART
ZnF_C2H2 897 919 6.88e-4 SMART
ZnF_C2H2 925 947 8.94e-3 SMART
ZnF_C2H2 954 976 2.27e-4 SMART
ZnF_C2H2 982 1005 9.3e-1 SMART
ZnF_C2H2 1029 1052 5.21e-4 SMART
low complexity region 1121 1131 N/A INTRINSIC
low complexity region 1200 1218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162173
SMART Domains Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335

DomainStartEndE-ValueType
ZnF_C2H2 12 35 2.45e0 SMART
ZnF_C2H2 116 136 1.53e2 SMART
low complexity region 220 236 N/A INTRINSIC
ZnF_C2H2 271 293 1.47e-3 SMART
ZnF_C2H2 299 321 1.18e-2 SMART
ZnF_C2H2 326 349 2.36e-2 SMART
ZnF_C2H2 354 377 4.4e-2 SMART
ZnF_C2H2 404 426 1.67e-2 SMART
ZnF_C2H2 432 454 1.33e-1 SMART
ZnF_C2H2 458 481 2.05e-2 SMART
low complexity region 601 617 N/A INTRINSIC
ZnF_C2H2 737 759 1.43e-1 SMART
ZnF_C2H2 765 788 3.52e-1 SMART
ZnF_C2H2 793 817 5.59e-4 SMART
ZnF_C2H2 825 848 3.83e-2 SMART
ZnF_C2H2 875 898 3.95e1 SMART
ZnF_C2H2 904 926 6.88e-4 SMART
ZnF_C2H2 932 954 8.94e-3 SMART
ZnF_C2H2 961 983 2.27e-4 SMART
ZnF_C2H2 989 1012 9.3e-1 SMART
ZnF_C2H2 1036 1059 5.21e-4 SMART
low complexity region 1133 1151 N/A INTRINSIC
Meta Mutation Damage Score 0.4352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Zfat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Zfat APN 15 68170222 missense possibly damaging 0.92
IGL00862:Zfat APN 15 68258663 splice site probably null
IGL01021:Zfat APN 15 68170166 missense possibly damaging 0.50
IGL01152:Zfat APN 15 68110504 missense probably damaging 1.00
IGL01733:Zfat APN 15 68180730 missense probably damaging 1.00
IGL01873:Zfat APN 15 68224895 missense probably benign 0.00
IGL01990:Zfat APN 15 68224817 missense probably damaging 1.00
IGL02066:Zfat APN 15 68180829 missense probably damaging 1.00
IGL02664:Zfat APN 15 68180721 missense probably damaging 1.00
IGL02955:Zfat APN 15 68181114 missense probably damaging 0.98
IGL03201:Zfat APN 15 68165909 missense probably damaging 1.00
R0145:Zfat UTSW 15 68187099 missense possibly damaging 0.95
R0408:Zfat UTSW 15 68180292 missense probably benign 0.10
R0633:Zfat UTSW 15 68180803 missense probably damaging 1.00
R1147:Zfat UTSW 15 68212583 splice site probably benign
R1508:Zfat UTSW 15 68178751 missense probably damaging 1.00
R1513:Zfat UTSW 15 68212680 missense probably damaging 1.00
R1641:Zfat UTSW 15 68180110 missense probably benign 0.19
R1889:Zfat UTSW 15 68101539 missense probably benign 0.00
R1959:Zfat UTSW 15 68146543 missense probably benign 0.32
R2030:Zfat UTSW 15 68118934 critical splice donor site probably null
R2202:Zfat UTSW 15 68179860 missense probably benign 0.36
R3440:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68084553 missense probably benign 0.00
R3442:Zfat UTSW 15 68101581 missense probably damaging 0.99
R4406:Zfat UTSW 15 68180191 missense probably benign 0.00
R4649:Zfat UTSW 15 68184476 missense probably damaging 1.00
R4710:Zfat UTSW 15 68180282 missense probably benign
R4712:Zfat UTSW 15 68110475 critical splice donor site probably null
R4745:Zfat UTSW 15 68180374 missense probably benign 0.09
R4862:Zfat UTSW 15 68180110 missense probably benign 0.02
R5015:Zfat UTSW 15 68178913 missense probably damaging 1.00
R5075:Zfat UTSW 15 68180230 missense probably benign
R5208:Zfat UTSW 15 68180721 missense probably damaging 1.00
R5277:Zfat UTSW 15 68165909 missense probably damaging 1.00
R5303:Zfat UTSW 15 68110486 missense probably damaging 1.00
R5328:Zfat UTSW 15 68179828 missense probably damaging 0.99
R5642:Zfat UTSW 15 68180916 missense probably damaging 1.00
R5659:Zfat UTSW 15 68119013 missense probably damaging 1.00
R5947:Zfat UTSW 15 68179957 missense probably benign
R6046:Zfat UTSW 15 68180777 missense probably damaging 0.99
R6315:Zfat UTSW 15 68084462 missense probably damaging 1.00
R6342:Zfat UTSW 15 68180982 missense probably damaging 1.00
R6573:Zfat UTSW 15 68165854 missense probably damaging 1.00
R6789:Zfat UTSW 15 68084386 missense probably damaging 1.00
R7028:Zfat UTSW 15 68180452 missense probably damaging 1.00
R7033:Zfat UTSW 15 68181015 missense probably damaging 1.00
R7039:Zfat UTSW 15 68180362 missense probably benign
R7065:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7144:Zfat UTSW 15 68178782 missense probably benign 0.12
R7208:Zfat UTSW 15 68180007 missense probably benign 0.39
R7330:Zfat UTSW 15 68212751 missense probably benign 0.00
R7345:Zfat UTSW 15 68105043 missense probably damaging 1.00
R7378:Zfat UTSW 15 68181120 missense probably damaging 1.00
R7405:Zfat UTSW 15 68184485 missense probably damaging 1.00
R7481:Zfat UTSW 15 68178866 nonsense probably null
R7672:Zfat UTSW 15 68258686 start codon destroyed probably null 0.39
R7676:Zfat UTSW 15 68224844 missense possibly damaging 0.88
R7701:Zfat UTSW 15 68180908 nonsense probably null
R7825:Zfat UTSW 15 68179920 missense probably benign 0.01
R8152:Zfat UTSW 15 68101506 missense probably benign 0.23
Z1088:Zfat UTSW 15 68187101 missense probably benign 0.00
Z1177:Zfat UTSW 15 68179828 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGTTAAGTTCTACTCTACACAAGC -3'
(R):5'- AGTCAGGGCTTGAGCAGTTC -3'

Sequencing Primer
(F):5'- CTCTACACAAGCTGAAGTTACGAGG -3'
(R):5'- TCTGAGAATCCATGAACACTCTGG -3'
Posted On2014-10-30