Incidental Mutation 'R2340:Vmn2r112'
ID246729
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Namevomeronasal 2, receptor 112
SynonymsEG628185
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22601148-22619133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22603115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 258 (V258E)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
Predicted Effect probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2342:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3237:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5446:Vmn2r112 UTSW 17 22618250 missense probably damaging 1.00
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6653:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6654:Vmn2r112 UTSW 17 22603469 missense possibly damaging 0.89
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
R8177:Vmn2r112 UTSW 17 22603613 missense possibly damaging 0.47
R8263:Vmn2r112 UTSW 17 22605159 missense probably damaging 1.00
R8395:Vmn2r112 UTSW 17 22618606 missense possibly damaging 0.94
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGCCTCTGATCATACATCTCTAGC -3'
(R):5'- TTGACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GATCATACATCTCTAGCCCTTGC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'
Posted On2014-10-30