Incidental Mutation 'R2340:Dsg1c'
ID246730
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20267888 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 149 (D149E)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably damaging
Transcript: ENSMUST00000054128
AA Change: D149E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: D149E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Meta Mutation Damage Score 0.6834 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3874:Dsg1c UTSW 18 20277052 missense probably benign 0.02
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
R8048:Dsg1c UTSW 18 20274767 missense probably damaging 1.00
R8092:Dsg1c UTSW 18 20281972 missense probably damaging 1.00
R8103:Dsg1c UTSW 18 20283114 missense probably damaging 1.00
R8117:Dsg1c UTSW 18 20276959 missense probably benign
R8192:Dsg1c UTSW 18 20266198 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Z1176:Dsg1c UTSW 18 20283573 missense probably damaging 1.00
Z1177:Dsg1c UTSW 18 20264949 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTATGTTTTCCCTTAAGCCTGAG -3'
(R):5'- GGCTGACACTGCAACTCTTC -3'

Sequencing Primer
(F):5'- GGTACCAAGGGAATGCCTCTATTC -3'
(R):5'- GACACTGCAACTCTTCCCTGAG -3'
Posted On2014-10-30