Incidental Mutation 'R2341:Olfr1122'
ID246736
Institutional Source Beutler Lab
Gene Symbol Olfr1122
Ensembl Gene ENSMUSG00000047594
Gene Nameolfactory receptor 1122
SynonymsGA_x6K02T2Q125-48880078-48881058, MOR264-1
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87385849-87391930 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87387740 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 12 (I12F)
Ref Sequence ENSEMBL: ENSMUSP00000149403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056435] [ENSMUST00000215371]
Predicted Effect probably benign
Transcript: ENSMUST00000056435
AA Change: I12F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052190
Gene: ENSMUSG00000047594
AA Change: I12F

DomainStartEndE-ValueType
Pfam:7tm_4 43 319 6.3e-51 PFAM
Pfam:7tm_1 53 302 5.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215371
AA Change: I12F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Olfr1122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1122 APN 2 87387843 missense possibly damaging 0.91
IGL01783:Olfr1122 APN 2 87387838 missense probably benign 0.39
IGL02396:Olfr1122 APN 2 87387705 utr 5 prime probably benign
IGL03338:Olfr1122 APN 2 87388126 missense probably benign 0.05
IGL03373:Olfr1122 APN 2 87388233 missense probably damaging 1.00
R0594:Olfr1122 UTSW 2 87387954 missense probably damaging 1.00
R1245:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1376:Olfr1122 UTSW 2 87387818 missense probably benign 0.00
R1471:Olfr1122 UTSW 2 87388518 missense probably damaging 1.00
R1681:Olfr1122 UTSW 2 87388620 missense possibly damaging 0.95
R1995:Olfr1122 UTSW 2 87387831 missense probably damaging 0.97
R2246:Olfr1122 UTSW 2 87387851 missense probably benign 0.00
R4008:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4009:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4011:Olfr1122 UTSW 2 87388580 missense possibly damaging 0.67
R4119:Olfr1122 UTSW 2 87387843 missense possibly damaging 0.91
R4547:Olfr1122 UTSW 2 87388160 missense probably benign 0.07
R4665:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4666:Olfr1122 UTSW 2 87387876 missense probably damaging 1.00
R4801:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R4802:Olfr1122 UTSW 2 87388209 missense probably benign 0.00
R5049:Olfr1122 UTSW 2 87388658 missense probably benign 0.00
R5070:Olfr1122 UTSW 2 87388163 missense probably damaging 1.00
R7594:Olfr1122 UTSW 2 87388269 missense probably damaging 1.00
R7684:Olfr1122 UTSW 2 87388028 missense probably damaging 0.99
R8064:Olfr1122 UTSW 2 87388509 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTCAGTAGCTCATCCTGTG -3'
(R):5'- TGCAGAGCAGAGTCAGTTC -3'

Sequencing Primer
(F):5'- CTCAGTAGCTCATCCTGTGAATATTG -3'
(R):5'- GAGCAGAGTCAGTTCTTGTTATTAAC -3'
Posted On2014-10-30