Incidental Mutation 'R2341:Usp30'
ID246747
Institutional Source Beutler Lab
Gene Symbol Usp30
Ensembl Gene ENSMUSG00000029592
Gene Nameubiquitin specific peptidase 30
SynonymsD5Ertd483e, 6330590F17Rik
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location114065461-114124720 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 114111180 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 182 (R182*)
Ref Sequence ENSEMBL: ENSMUSP00000142350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031588] [ENSMUST00000200119]
Predicted Effect probably null
Transcript: ENSMUST00000031588
AA Change: R182*
SMART Domains Protein: ENSMUSP00000031588
Gene: ENSMUSG00000029592
AA Change: R182*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 499 2.6e-44 PFAM
Pfam:UCH_1 68 481 8.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198457
Predicted Effect probably null
Transcript: ENSMUST00000200119
AA Change: R182*
SMART Domains Protein: ENSMUSP00000142350
Gene: ENSMUSG00000029592
AA Change: R182*

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:UCH 67 368 2.9e-31 PFAM
Pfam:UCH_1 68 376 1e-14 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] USP30, a member of the ubiquitin-specific protease family (see USP1, MIM 603478), is a novel mitochondrial deubiquitinating (DUB) enzyme (Nakamura and Hirose, 2008 [PubMed 18287522]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Usp30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03353:Usp30 APN 5 114121058 missense probably benign 0.00
IGL03384:Usp30 APN 5 114121574 missense probably damaging 1.00
R0095:Usp30 UTSW 5 114105840 missense probably damaging 1.00
R0972:Usp30 UTSW 5 114111864 splice site probably benign
R1184:Usp30 UTSW 5 114103827 critical splice donor site probably null
R1589:Usp30 UTSW 5 114112961 missense probably damaging 1.00
R1678:Usp30 UTSW 5 114121146 missense probably damaging 1.00
R2127:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R2129:Usp30 UTSW 5 114111163 missense probably damaging 1.00
R4677:Usp30 UTSW 5 114119644 missense probably damaging 1.00
R5191:Usp30 UTSW 5 114065694 start gained probably benign
R5956:Usp30 UTSW 5 114119621 missense possibly damaging 0.89
R6730:Usp30 UTSW 5 114103709 missense probably damaging 1.00
R6947:Usp30 UTSW 5 114103760 missense probably benign 0.01
R7572:Usp30 UTSW 5 114120247 missense probably benign 0.15
R7653:Usp30 UTSW 5 114121669 missense probably damaging 1.00
R7654:Usp30 UTSW 5 114102445 missense probably damaging 1.00
R7794:Usp30 UTSW 5 114112972 nonsense probably null
R8063:Usp30 UTSW 5 114100463 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTCTCCTTCAGTTATTGGGAC -3'
(R):5'- AGTGTGCCCTGTTCTTACTGAG -3'

Sequencing Primer
(F):5'- CTCCTTCAGTTATTGGGACTCAGAG -3'
(R):5'- CTGTTCTTACTGAGTGTGAACAC -3'
Posted On2014-10-30