Incidental Mutation 'R2341:Anxa4'
ID246748
Institutional Source Beutler Lab
Gene Symbol Anxa4
Ensembl Gene ENSMUSG00000029994
Gene Nameannexin A4
Synonymsannexin IV, Xanx-4, AIV, Anx4
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86736840-86793584 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86743153 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 144 (S144P)
Ref Sequence ENSEMBL: ENSMUSP00000117378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001187] [ENSMUST00000113675] [ENSMUST00000123732] [ENSMUST00000127152] [ENSMUST00000155456] [ENSMUST00000204398] [ENSMUST00000204441]
Predicted Effect probably benign
Transcript: ENSMUST00000001187
AA Change: S248P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000001187
Gene: ENSMUSG00000029994
AA Change: S248P

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113675
AA Change: S248P

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109305
Gene: ENSMUSG00000029994
AA Change: S248P

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
ANX 187 239 9.84e-23 SMART
ANX 262 314 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123732
AA Change: S226P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115346
Gene: ENSMUSG00000029994
AA Change: S226P

DomainStartEndE-ValueType
ANX 31 79 1.6e-13 SMART
ANX 81 133 6.69e-25 SMART
ANX 165 217 9.84e-23 SMART
Pfam:Annexin 227 254 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127152
SMART Domains Protein: ENSMUSP00000138194
Gene: ENSMUSG00000029994

DomainStartEndE-ValueType
ANX 31 83 1.66e-20 SMART
ANX 103 155 6.69e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135921
Predicted Effect probably benign
Transcript: ENSMUST00000155456
AA Change: S144P

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000117378
Gene: ENSMUSG00000029994
AA Change: S144P

DomainStartEndE-ValueType
ANX 22 69 1.06e-2 SMART
ANX 83 135 9.84e-23 SMART
ANX 158 210 2.37e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204398
AA Change: S248P

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000144961
Gene: ENSMUSG00000029994
AA Change: S248P

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204441
AA Change: S248P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000145421
Gene: ENSMUSG00000029994
AA Change: S248P

DomainStartEndE-ValueType
ANX 31 83 7.1e-23 SMART
ANX 103 155 2.8e-27 SMART
ANX 187 239 4.3e-25 SMART
Pfam:Annexin 249 274 5.4e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele often display abnormal maternal nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Anxa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Anxa4 APN 6 86752205 missense probably damaging 1.00
IGL02601:Anxa4 APN 6 86760701 missense probably benign 0.00
R0423:Anxa4 UTSW 6 86760737 missense probably damaging 1.00
R0948:Anxa4 UTSW 6 86741931 missense probably damaging 1.00
R1846:Anxa4 UTSW 6 86741911 unclassified probably null
R4058:Anxa4 UTSW 6 86757818 critical splice donor site probably null
R5000:Anxa4 UTSW 6 86765784 utr 5 prime probably benign
R5390:Anxa4 UTSW 6 86753883 missense probably damaging 1.00
R6503:Anxa4 UTSW 6 86744667 missense probably damaging 1.00
R6897:Anxa4 UTSW 6 86743178 critical splice acceptor site probably null
R7625:Anxa4 UTSW 6 86737819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATAGAGCGCAGGGATCAG -3'
(R):5'- TTGGGACTTTGTAGAAACTGAGAC -3'

Sequencing Primer
(F):5'- GGATCAGGGCTCCACACATC -3'
(R):5'- TGTAGAAACTGAGACTGTCATTTTTC -3'
Posted On2014-10-30