Incidental Mutation 'R2341:Dock6'
ID246753
Institutional Source Beutler Lab
Gene Symbol Dock6
Ensembl Gene ENSMUSG00000032198
Gene Namededicator of cytokinesis 6
Synonyms2410095B20Rik, C330023D02Rik, 4931431C02Rik
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21799860-21852635 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 21839486 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000149156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034728] [ENSMUST00000058777] [ENSMUST00000217336]
Predicted Effect probably benign
Transcript: ENSMUST00000034728
SMART Domains Protein: ENSMUSP00000034728
Gene: ENSMUSG00000032198

DomainStartEndE-ValueType
low complexity region 26 42 N/A INTRINSIC
Pfam:DUF3398 63 155 4.7e-26 PFAM
low complexity region 419 429 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
Pfam:DOCK-C2 542 721 3.4e-46 PFAM
low complexity region 754 770 N/A INTRINSIC
low complexity region 776 787 N/A INTRINSIC
low complexity region 945 965 N/A INTRINSIC
low complexity region 1057 1072 N/A INTRINSIC
low complexity region 1123 1153 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
Pfam:DHR-2 1554 2080 6.6e-214 PFAM
low complexity region 2093 2107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058777
SMART Domains Protein: ENSMUSP00000058951
Gene: ENSMUSG00000047822

DomainStartEndE-ValueType
low complexity region 171 191 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213775
Predicted Effect probably benign
Transcript: ENSMUST00000217336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis (DOCK) family of atypical guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with small GTPases and are components of intracellular signaling networks. The encoded protein is a group C DOCK protein and plays a role in actin cytoskeletal reorganization by activating the Rho GTPases Cdc42 and Rac1. Mutations in this gene are associated with Adams-Oliver syndrome 2. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Dock6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Dock6 APN 9 21846634 missense possibly damaging 0.50
IGL01025:Dock6 APN 9 21811807 missense possibly damaging 0.89
IGL01390:Dock6 APN 9 21803045 missense probably damaging 1.00
IGL02025:Dock6 APN 9 21809589 missense probably damaging 0.98
IGL02028:Dock6 APN 9 21838826 missense probably damaging 1.00
IGL02311:Dock6 APN 9 21844328 missense probably damaging 1.00
IGL02441:Dock6 APN 9 21841926 missense possibly damaging 0.77
IGL02504:Dock6 APN 9 21846655 missense probably benign 0.19
IGL02516:Dock6 APN 9 21802585 missense probably damaging 1.00
IGL02836:Dock6 APN 9 21801864 missense probably damaging 1.00
IGL02894:Dock6 APN 9 21811815 missense probably damaging 1.00
bayfront UTSW 9 21821745 missense probably benign 0.29
IGL03048:Dock6 UTSW 9 21809570 missense probably damaging 1.00
R0370:Dock6 UTSW 9 21814565 missense probably benign 0.29
R0504:Dock6 UTSW 9 21802436 missense probably damaging 1.00
R0633:Dock6 UTSW 9 21844417 missense probably benign 0.00
R0634:Dock6 UTSW 9 21841527 missense probably damaging 1.00
R0671:Dock6 UTSW 9 21804627 splice site probably benign
R0839:Dock6 UTSW 9 21817892 missense probably benign 0.01
R0948:Dock6 UTSW 9 21801533 missense probably damaging 1.00
R1022:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1024:Dock6 UTSW 9 21833612 missense probably damaging 1.00
R1073:Dock6 UTSW 9 21846518 missense probably benign
R1463:Dock6 UTSW 9 21831906 missense probably damaging 1.00
R1481:Dock6 UTSW 9 21820622 missense probably benign
R1494:Dock6 UTSW 9 21814742 missense probably benign 0.34
R1547:Dock6 UTSW 9 21814588 missense probably damaging 1.00
R1654:Dock6 UTSW 9 21804843 missense probably damaging 0.98
R1782:Dock6 UTSW 9 21811846 missense probably damaging 1.00
R1905:Dock6 UTSW 9 21829574 missense probably benign 0.37
R1908:Dock6 UTSW 9 21841629 missense probably damaging 1.00
R1916:Dock6 UTSW 9 21813091 missense probably damaging 1.00
R2132:Dock6 UTSW 9 21846518 missense probably benign
R2197:Dock6 UTSW 9 21832881 missense probably damaging 1.00
R2316:Dock6 UTSW 9 21839677 missense probably damaging 0.98
R2519:Dock6 UTSW 9 21816333 missense possibly damaging 0.54
R2924:Dock6 UTSW 9 21809630 missense probably damaging 1.00
R2939:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R2940:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3078:Dock6 UTSW 9 21845754 splice site probably benign
R3081:Dock6 UTSW 9 21839200 missense possibly damaging 0.88
R3810:Dock6 UTSW 9 21801577 missense probably damaging 1.00
R4246:Dock6 UTSW 9 21839490 splice site probably null
R4604:Dock6 UTSW 9 21802540 missense probably damaging 1.00
R4833:Dock6 UTSW 9 21844280 missense probably damaging 1.00
R4849:Dock6 UTSW 9 21811772 critical splice donor site probably null
R4896:Dock6 UTSW 9 21824437 missense possibly damaging 0.48
R4926:Dock6 UTSW 9 21845791 missense probably damaging 1.00
R5183:Dock6 UTSW 9 21841603 missense probably benign 0.00
R5211:Dock6 UTSW 9 21820352 missense probably benign 0.36
R5337:Dock6 UTSW 9 21829548 missense possibly damaging 0.93
R5353:Dock6 UTSW 9 21814786 missense probably benign 0.00
R5429:Dock6 UTSW 9 21832881 missense probably damaging 0.99
R5463:Dock6 UTSW 9 21809958 intron probably null
R5476:Dock6 UTSW 9 21809589 missense probably damaging 0.98
R5511:Dock6 UTSW 9 21817407 missense possibly damaging 0.59
R5534:Dock6 UTSW 9 21803076 nonsense probably null
R5718:Dock6 UTSW 9 21824493 missense probably benign 0.11
R5823:Dock6 UTSW 9 21804828 missense probably damaging 0.99
R5831:Dock6 UTSW 9 21803036 missense probably damaging 1.00
R5887:Dock6 UTSW 9 21820394 missense probably damaging 0.96
R5930:Dock6 UTSW 9 21824416 missense probably benign 0.29
R6159:Dock6 UTSW 9 21821745 missense probably benign 0.29
R6633:Dock6 UTSW 9 21820331 missense probably benign 0.17
R6633:Dock6 UTSW 9 21821503 missense probably damaging 1.00
R6665:Dock6 UTSW 9 21839912 missense probably damaging 0.99
R6744:Dock6 UTSW 9 21831474 missense probably damaging 1.00
R6903:Dock6 UTSW 9 21809564 missense probably damaging 1.00
R6981:Dock6 UTSW 9 21845550 missense probably damaging 0.99
R7024:Dock6 UTSW 9 21820370 missense probably benign
R7030:Dock6 UTSW 9 21813079 missense probably damaging 1.00
R7045:Dock6 UTSW 9 21821811 missense probably damaging 1.00
R7139:Dock6 UTSW 9 21801276 missense probably damaging 1.00
R7356:Dock6 UTSW 9 21809899 missense probably damaging 1.00
R7400:Dock6 UTSW 9 21801807 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCTGAAAGTTCCCAAGATAGATGG -3'
(R):5'- TTGGCCAACATCGTGAGCAG -3'

Sequencing Primer
(F):5'- CCCAGGAGGAAAAGAAATCTGTTTTC -3'
(R):5'- AACATCGTGAGCAGGCCCC -3'
Posted On2014-10-30