Mutagenetix > Incidental Mutations

Incidental Mutation 'R2341:Scel'

246764

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

040327-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2341 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103608170 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 580 (L580F)

Ref Sequence

ENSEMBL: ENSMUSP00000154402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095576
AA Change: L600F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: L600F

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227322
AA Change: L580F

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.0964

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.7%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017D01Rik	T	A	19: 11,105,793	M88L	probably benign	Het
4933412E24Rik	A	G	15: 60,016,363	V76A	possibly damaging	Het
Aif1	G	A	17: 35,172,151	P44L	probably benign	Het
Anapc4	T	C	5: 52,841,937		probably benign	Het
Anxa4	A	G	6: 86,743,153	S144P	probably benign	Het
Bcr	A	G	10: 75,131,112	E517G	probably damaging	Het
Ccdc57	T	C	11: 120,860,523	E907G	probably benign	Het
Chd6	TG	T	2: 160,965,759		probably null	Het
Dock6	A	G	9: 21,839,486		probably benign	Het
Dock8	A	G	19: 25,200,393	K2031E	probably damaging	Het
Gm5444	T	C	13: 4,834,345		noncoding transcript	Het
Hlx	G	T	1: 184,731,987	A52D	probably damaging	Het
Ifna16	A	G	4: 88,676,328	S177P	probably damaging	Het
Ino80d	T	C	1: 63,065,826	N364D	possibly damaging	Het
Ltbp2	T	C	12: 84,809,163	T769A	probably benign	Het
Mug1	T	C	6: 121,884,629	V1350A	probably benign	Het
Nedd9	A	G	13: 41,316,511	S389P	probably damaging	Het
Olfr1098	T	C	2: 86,922,638	K298R	possibly damaging	Het
Olfr1122	A	T	2: 87,387,740	I12F	probably benign	Het
Olfr1201	A	G	2: 88,794,645	N88D	probably benign	Het
Pole	A	T	5: 110,330,963	I28F	possibly damaging	Het
Prkce	C	A	17: 86,474,442	P180T	probably damaging	Het
Ralgapa1	T	C	12: 55,677,124	H1995R	possibly damaging	Het
Rnf144b	A	G	13: 47,220,500	K58E	probably benign	Het
Rnf43	A	G	11: 87,732,025	R651G	probably damaging	Het
Scn4b	G	A	9: 45,147,829	V133M	probably damaging	Het
Sipa1l3	T	C	7: 29,377,635	N904S	probably damaging	Het
Sun5	A	G	2: 153,867,502		probably benign	Het
Tanc2	T	C	11: 105,835,051	V347A	probably benign	Het
Tmem245	T	C	4: 56,937,957	Y197C	probably damaging	Het
Usp30	C	T	5: 114,111,180	R182*	probably null	Het
Vmn2r112	T	A	17: 22,603,115	V258E	probably damaging	Het
Vps35	T	C	8: 85,274,814		probably benign	Het
Xkr7	G	A	2: 153,054,398	V391M	possibly damaging	Het
Ythdf3	A	T	3: 16,203,215		probably benign	Het
Zfp110	T	C	7: 12,849,186	V587A	probably benign	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6062:Scel	UTSW	14	103585136	missense	possibly damaging	0.82
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- ATGAATCATGTGAGGCTTTTCC -3'
(R):5'- TAGACCTTTGAGGGTGACGC -3'

Sequencing Primer
(F):5'- GTTCTTACATCCTAAAACCCCATCAG -3'
(R):5'- CTGCAGAGCACCTAGGGACATG -3'

Posted On

2014-10-30