Incidental Mutation 'R2341:4933412E24Rik'
ID246765
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene NameRIKEN cDNA 4933412E24 gene
Synonyms
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location60014866-60016613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60016363 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096421
AA Change: V76A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: V76A

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 60015575 missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 60016330 missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 60016463 missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 60016402 missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 60015472 missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 60015311 missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 60015345 nonsense probably null
R2440:4933412E24Rik UTSW 15 60016280 missense probably benign
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 60016285 missense probably damaging 1.00
R4039:4933412E24Rik UTSW 15 60016366 missense possibly damaging 0.95
R4416:4933412E24Rik UTSW 15 60016423 missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 60015968 missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 60016108 missense probably benign 0.00
R5462:4933412E24Rik UTSW 15 60015068 missense probably benign 0.09
R7275:4933412E24Rik UTSW 15 60015889 missense probably benign 0.32
R7842:4933412E24Rik UTSW 15 60016573 missense probably damaging 1.00
R8261:4933412E24Rik UTSW 15 60016576 missense probably benign 0.44
R8297:4933412E24Rik UTSW 15 60015675 missense probably damaging 1.00
X0052:4933412E24Rik UTSW 15 60016526 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTTGCCTCCTCGGAAGCTTG -3'
(R):5'- TTTTATGAGGAGAGTGGAGACCTC -3'

Sequencing Primer
(F):5'- TGATGGAGCCTGCCTCTGTC -3'
(R):5'- AGACCTCAACACGGGCTTGAG -3'
Posted On2014-10-30