Incidental Mutation 'R2341:Aif1'
ID246767
Institutional Source Beutler Lab
Gene Symbol Aif1
Ensembl Gene ENSMUSG00000024397
Gene Nameallograft inflammatory factor 1
SynonymsD17H6S50E, Iba1, G1
MMRRC Submission 040327-MU
Accession Numbers

Genbank: NM_019467; MGI: 1343098

Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R2341 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35170991-35176068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35172151 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 44 (P44L)
Ref Sequence ENSEMBL: ENSMUSP00000134107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025257] [ENSMUST00000172693] [ENSMUST00000173106] [ENSMUST00000173324]
Predicted Effect probably benign
Transcript: ENSMUST00000025257
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025257
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172679
Predicted Effect probably benign
Transcript: ENSMUST00000172693
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134214
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173106
AA Change: P44L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134107
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 128 4e-47 PDB
Blast:EFh 98 122 4e-9 BLAST
SCOP:d1mr8a_ 98 128 7e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173281
Predicted Effect probably benign
Transcript: ENSMUST00000173324
AA Change: P44L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133709
Gene: ENSMUSG00000024397
AA Change: P44L

DomainStartEndE-ValueType
PDB:1WY9|A 1 147 1e-104 PDB
SCOP:d1mr8a_ 48 130 7e-10 SMART
Blast:EFh 49 77 1e-10 BLAST
Blast:EFh 85 113 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174044
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds actin and calcium. This gene is induced by cytokines and interferon and may promote macrophage activation and growth of vascular smooth muscle cells and T-lymphocytes. Polymorphisms in this gene may be associated with systemic sclerosis. Alternative splicing results in multiple transcript variants, but the full-length and coding nature of some of these variants is not certain. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased spleen weight, decreased platalet cell number and decreased susceptibility to induced arthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Pole A T 5: 110,330,963 I28F possibly damaging Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Aif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Aif1 APN 17 35171555 missense probably damaging 1.00
IGL03279:Aif1 APN 17 35171547 nonsense probably null
N/A:Aif1 UTSW 17 35172520 missense possibly damaging 0.83
R0396:Aif1 UTSW 17 35171109 makesense probably null
R1062:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1063:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1064:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1105:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1122:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1154:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1286:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1447:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1678:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1689:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1750:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1911:Aif1 UTSW 17 35172151 missense probably benign 0.01
R1974:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2314:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2338:Aif1 UTSW 17 35172151 missense probably benign 0.01
R2915:Aif1 UTSW 17 35172151 missense probably benign 0.01
R4953:Aif1 UTSW 17 35171098 unclassified probably null
R5260:Aif1 UTSW 17 35171941 critical splice acceptor site probably null
R6786:Aif1 UTSW 17 35171496 missense probably damaging 1.00
R7503:Aif1 UTSW 17 35171573 missense probably damaging 1.00
R7534:Aif1 UTSW 17 35171414 missense possibly damaging 0.77
R7891:Aif1 UTSW 17 35172624 start gained probably benign
R7974:Aif1 UTSW 17 35172624 start gained probably benign
Y4338:Aif1 UTSW 17 35172151 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTGGTGGCTGAGCAATGC -3'
(R):5'- GCTTTTGGACTGCTGAAGGC -3'

Sequencing Primer
(F):5'- CTGAGCAATGCCAGGGTAG -3'
(R):5'- CTGAAGGCCCAGCAGGAAG -3'
Posted On2014-10-30