Incidental Mutation 'R2341:Dock8'
ID 246771
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission 040327-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R2341 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25177757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2031 (K2031E)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000025831
AA Change: K2031E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: K2031E

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Meta Mutation Damage Score 0.2137 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik A G 15: 59,888,212 (GRCm39) V76A possibly damaging Het
Aif1 G A 17: 35,391,127 (GRCm39) P44L probably benign Het
Anapc4 T C 5: 52,999,279 (GRCm39) probably benign Het
Anxa4 A G 6: 86,720,135 (GRCm39) S144P probably benign Het
Bcr A G 10: 74,966,944 (GRCm39) E517G probably damaging Het
Ccdc57 T C 11: 120,751,349 (GRCm39) E907G probably benign Het
Chd6 TG T 2: 160,807,679 (GRCm39) probably null Het
Dock6 A G 9: 21,750,782 (GRCm39) probably benign Het
Gm5444 T C 13: 4,884,344 (GRCm39) noncoding transcript Het
Hlx G T 1: 184,464,184 (GRCm39) A52D probably damaging Het
Ifna16 A G 4: 88,594,565 (GRCm39) S177P probably damaging Het
Ino80d T C 1: 63,104,985 (GRCm39) N364D possibly damaging Het
Ltbp2 T C 12: 84,855,937 (GRCm39) T769A probably benign Het
Ms4a20 T A 19: 11,083,157 (GRCm39) M88L probably benign Het
Mug1 T C 6: 121,861,588 (GRCm39) V1350A probably benign Het
Nedd9 A G 13: 41,469,987 (GRCm39) S389P probably damaging Het
Or10ag57 A T 2: 87,218,084 (GRCm39) I12F probably benign Het
Or4c11b A G 2: 88,624,989 (GRCm39) N88D probably benign Het
Or8h8 T C 2: 86,752,982 (GRCm39) K298R possibly damaging Het
Pole A T 5: 110,478,829 (GRCm39) I28F possibly damaging Het
Prkce C A 17: 86,781,870 (GRCm39) P180T probably damaging Het
Ralgapa1 T C 12: 55,723,909 (GRCm39) H1995R possibly damaging Het
Rnf144b A G 13: 47,373,976 (GRCm39) K58E probably benign Het
Rnf43 A G 11: 87,622,851 (GRCm39) R651G probably damaging Het
Scel A T 14: 103,845,606 (GRCm39) L580F possibly damaging Het
Scn4b G A 9: 45,059,127 (GRCm39) V133M probably damaging Het
Sipa1l3 T C 7: 29,077,060 (GRCm39) N904S probably damaging Het
Sun5 A G 2: 153,709,422 (GRCm39) probably benign Het
Tanc2 T C 11: 105,725,877 (GRCm39) V347A probably benign Het
Tmem245 T C 4: 56,937,957 (GRCm39) Y197C probably damaging Het
Usp30 C T 5: 114,249,241 (GRCm39) R182* probably null Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Vps35 T C 8: 86,001,443 (GRCm39) probably benign Het
Xkr7 G A 2: 152,896,318 (GRCm39) V391M possibly damaging Het
Ythdf3 A T 3: 16,257,379 (GRCm39) probably benign Het
Zfp110 T C 7: 12,583,113 (GRCm39) V587A probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9699:Dock8 UTSW 19 25,133,388 (GRCm39) critical splice donor site probably null
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGAGTTCCAGAGCCTCATGAC -3'
(R):5'- CCATGATCTCTGATGCCCAG -3'

Sequencing Primer
(F):5'- AGAGCCTCATGACGCAATC -3'
(R):5'- TCTCTGATGCCCAGGAAGAG -3'
Posted On 2014-10-30