Incidental Mutation 'R2342:Orc4'
ID246776
Institutional Source Beutler Lab
Gene Symbol Orc4
Ensembl Gene ENSMUSG00000026761
Gene Nameorigin recognition complex, subunit 4
SynonymsmMmORC4, Orc4, Orc4l, Orc4P
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R2342 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48902824-48950277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48927140 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 179 (S179P)
Ref Sequence ENSEMBL: ENSMUSP00000119274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028098] [ENSMUST00000090976] [ENSMUST00000142851]
Predicted Effect probably damaging
Transcript: ENSMUST00000028098
AA Change: S179P

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000028098
Gene: ENSMUSG00000026761
AA Change: S179P

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Pfam:ORC4_C 225 413 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090976
SMART Domains Protein: ENSMUSP00000088497
Gene: ENSMUSG00000026761

DomainStartEndE-ValueType
Pfam:AAA_16 34 138 3.3e-14 PFAM
Pfam:KAP_NTPase 38 123 2.9e-7 PFAM
Pfam:Arch_ATPase 43 130 4.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141441
Predicted Effect probably damaging
Transcript: ENSMUST00000142851
AA Change: S179P

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119274
Gene: ENSMUSG00000026761
AA Change: S179P

DomainStartEndE-ValueType
AAA 57 199 2.75e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154784
Meta Mutation Damage Score 0.7471 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunit protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. This gene encodes a subunit of the ORC complex. Several alternatively spliced transcript variants, some of which encode the same protein, have been reported for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Frmd6 C A 12: 70,883,818 Y237* probably null Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Meis1 C T 11: 18,881,647 A464T probably damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rnf169 T C 7: 99,925,445 K648E possibly damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Tbl2 G A 5: 135,158,753 R288Q possibly damaging Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Orc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Orc4 APN 2 48910269 missense probably benign
IGL01523:Orc4 APN 2 48917224 missense probably benign 0.00
IGL02546:Orc4 APN 2 48917284 missense probably null 0.02
IGL02592:Orc4 APN 2 48933078 critical splice donor site probably null
R0277:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0323:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0554:Orc4 UTSW 2 48905421 missense probably benign 0.01
R0573:Orc4 UTSW 2 48917273 missense probably benign 0.05
R0788:Orc4 UTSW 2 48937467 missense possibly damaging 0.78
R0893:Orc4 UTSW 2 48932610 unclassified probably benign
R1112:Orc4 UTSW 2 48933572 missense probably damaging 0.97
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1466:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1584:Orc4 UTSW 2 48909494 missense possibly damaging 0.91
R1868:Orc4 UTSW 2 48910293 missense probably benign 0.07
R2370:Orc4 UTSW 2 48933099 missense probably benign 0.01
R3085:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3086:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3122:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3404:Orc4 UTSW 2 48937489 missense probably benign 0.01
R3551:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4199:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4515:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4518:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4519:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4521:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4523:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4529:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4532:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4533:Orc4 UTSW 2 48937489 missense probably benign 0.01
R4652:Orc4 UTSW 2 48936750 unclassified probably benign
R4845:Orc4 UTSW 2 48909466 missense probably benign 0.07
R5893:Orc4 UTSW 2 48905547 nonsense probably null
R6708:Orc4 UTSW 2 48937493 missense probably benign 0.00
R6972:Orc4 UTSW 2 48927184 missense probably benign 0.03
R7572:Orc4 UTSW 2 48910236 missense probably benign 0.01
R7938:Orc4 UTSW 2 48910191 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTCTTGTTTACCTCAACTGGAAAGC -3'
(R):5'- GTAACTTACCAATGTGTGTTGACCTG -3'

Sequencing Primer
(F):5'- CCTCAACTGGAAAGCAGTATTAATG -3'
(R):5'- GCCCAGTGATCTTCATAC -3'
Posted On2014-10-30