Incidental Mutation 'R2342:Tbl2'
ID246782
Institutional Source Beutler Lab
Gene Symbol Tbl2
Ensembl Gene ENSMUSG00000005374
Gene Nametransducin (beta)-like 2
SynonymsC76179, WS-bTRP
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R2342 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location135149657-135165760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135158753 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 288 (R288Q)
Ref Sequence ENSEMBL: ENSMUSP00000115011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005508] [ENSMUST00000139565] [ENSMUST00000152013] [ENSMUST00000153183] [ENSMUST00000201780]
Predicted Effect probably benign
Transcript: ENSMUST00000005508
SMART Domains Protein: ENSMUSP00000005508
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139565
SMART Domains Protein: ENSMUSP00000120685
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152013
SMART Domains Protein: ENSMUSP00000118691
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
WD40 40 79 1.89e-9 SMART
Blast:WD40 87 126 3e-15 BLAST
WD40 138 177 1.67e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153183
AA Change: R288Q

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374
AA Change: R288Q

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201780
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-transducin protein family. Most proteins of the beta-transducin family are involved in regulatory functions. This protein is possibly involved in some intracellular signaling pathway. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Frmd6 C A 12: 70,883,818 Y237* probably null Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Meis1 C T 11: 18,881,647 A464T probably damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Orc4 A G 2: 48,927,140 S179P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rnf169 T C 7: 99,925,445 K648E possibly damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Tbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Tbl2 APN 5 135156363 unclassified probably benign
IGL02669:Tbl2 APN 5 135152998 missense probably damaging 1.00
R1160:Tbl2 UTSW 5 135159392 missense probably benign 0.01
R1909:Tbl2 UTSW 5 135152991 missense probably damaging 1.00
R1945:Tbl2 UTSW 5 135157600 missense possibly damaging 0.56
R2156:Tbl2 UTSW 5 135156520 critical splice donor site probably null
R2392:Tbl2 UTSW 5 135156514 missense probably benign 0.10
R3813:Tbl2 UTSW 5 135156521 critical splice donor site probably null
R5560:Tbl2 UTSW 5 135157591 nonsense probably null
R6301:Tbl2 UTSW 5 135159369 missense probably benign
R6723:Tbl2 UTSW 5 135159276 missense probably damaging 1.00
R6816:Tbl2 UTSW 5 135159215 splice site probably null
R7136:Tbl2 UTSW 5 135149828 missense probably benign 0.23
R7288:Tbl2 UTSW 5 135154399 missense possibly damaging 0.92
R7720:Tbl2 UTSW 5 135159475 missense probably damaging 1.00
X0024:Tbl2 UTSW 5 135159591 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACGCCCGGCTAACATTTGAG -3'
(R):5'- TCCACCCTTTTCAGAACTGCAG -3'

Sequencing Primer
(F):5'- GCCCGGCTAACATTTGAGTTTTAAG -3'
(R):5'- TCACTGTAAGTTCAAGGGCAGCC -3'
Posted On2014-10-30