Incidental Mutation 'R2342:Rnf169'
ID246785
Institutional Source Beutler Lab
Gene Symbol Rnf169
Ensembl Gene ENSMUSG00000058761
Gene Namering finger protein 169
Synonyms2900057K09Rik
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R2342 (G1)
Quality Score135
Status Validated
Chromosome7
Chromosomal Location99920254-99980448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99925445 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 648 (K648E)
Ref Sequence ENSEMBL: ENSMUSP00000079631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080817
AA Change: K648E

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079631
Gene: ENSMUSG00000058761
AA Change: K648E

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
RING 61 96 3.16e-1 SMART
Blast:RING 133 176 7e-8 BLAST
low complexity region 302 314 N/A INTRINSIC
low complexity region 649 661 N/A INTRINSIC
Meta Mutation Damage Score 0.0621 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Frmd6 C A 12: 70,883,818 Y237* probably null Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Meis1 C T 11: 18,881,647 A464T probably damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Orc4 A G 2: 48,927,140 S179P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Tbl2 G A 5: 135,158,753 R288Q possibly damaging Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Rnf169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Rnf169 APN 7 99955484 missense probably damaging 1.00
IGL02344:Rnf169 APN 7 99926435 missense probably damaging 1.00
IGL03066:Rnf169 APN 7 99925553 missense possibly damaging 0.85
R0201:Rnf169 UTSW 7 99926003 missense possibly damaging 0.85
R1087:Rnf169 UTSW 7 99942997 missense probably benign 0.01
R1289:Rnf169 UTSW 7 99925736 missense probably benign 0.01
R1476:Rnf169 UTSW 7 99925328 missense possibly damaging 0.72
R1912:Rnf169 UTSW 7 99926254 missense probably damaging 1.00
R1964:Rnf169 UTSW 7 99925525 missense probably damaging 1.00
R2057:Rnf169 UTSW 7 99925408 missense probably damaging 1.00
R4755:Rnf169 UTSW 7 99925723 missense probably benign 0.01
R4801:Rnf169 UTSW 7 99926446 missense probably damaging 1.00
R4802:Rnf169 UTSW 7 99926446 missense probably damaging 1.00
R5391:Rnf169 UTSW 7 99935160 critical splice donor site probably null
R5395:Rnf169 UTSW 7 99935160 critical splice donor site probably null
R5643:Rnf169 UTSW 7 99927131 missense possibly damaging 0.85
R5817:Rnf169 UTSW 7 99925769 missense probably benign 0.02
R5952:Rnf169 UTSW 7 99925633 missense probably damaging 1.00
R6009:Rnf169 UTSW 7 99927123 missense possibly damaging 0.92
R6453:Rnf169 UTSW 7 99935227 missense probably benign 0.01
R7238:Rnf169 UTSW 7 99925747 missense probably benign 0.10
R7500:Rnf169 UTSW 7 99980238 missense probably damaging 0.99
R8194:Rnf169 UTSW 7 99926444 missense probably damaging 1.00
Z1177:Rnf169 UTSW 7 99925861 missense not run
Predicted Primers PCR Primer
(F):5'- TGAGAACATTCAGCTAGCTCTTTTG -3'
(R):5'- GGGTAATGGCATTCTGGTCAAC -3'

Sequencing Primer
(F):5'- GCTAGCTCTTTTGGATAAATGACAGG -3'
(R):5'- CTGGTCAACAGCCTAGGAGAG -3'
Posted On2014-10-30