Incidental Mutation 'R2342:Frmd6'
ID246794
Institutional Source Beutler Lab
Gene Symbol Frmd6
Ensembl Gene ENSMUSG00000048285
Gene NameFERM domain containing 6
Synonyms
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2342 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70825514-70902234 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 70883818 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 237 (Y237*)
Ref Sequence ENSEMBL: ENSMUSP00000052202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057859]
Predicted Effect probably null
Transcript: ENSMUST00000057859
AA Change: Y237*
SMART Domains Protein: ENSMUSP00000052202
Gene: ENSMUSG00000048285
AA Change: Y237*

DomainStartEndE-ValueType
B41 13 234 2.41e-25 SMART
FERM_C 241 332 9.63e-19 SMART
low complexity region 365 375 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 425 442 N/A INTRINSIC
low complexity region 506 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222802
Meta Mutation Damage Score 0.6268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Meis1 C T 11: 18,881,647 A464T probably damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Orc4 A G 2: 48,927,140 S179P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rnf169 T C 7: 99,925,445 K648E possibly damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Tbl2 G A 5: 135,158,753 R288Q possibly damaging Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Frmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Frmd6 UTSW 12 70883762 missense probably damaging 1.00
R0662:Frmd6 UTSW 12 70899444 nonsense probably null
R0747:Frmd6 UTSW 12 70864056 missense probably benign
R1144:Frmd6 UTSW 12 70877168 missense probably damaging 1.00
R1366:Frmd6 UTSW 12 70887889 splice site probably benign
R1763:Frmd6 UTSW 12 70893622 missense possibly damaging 0.90
R2135:Frmd6 UTSW 12 70894997 missense probably benign 0.00
R3963:Frmd6 UTSW 12 70893864 missense probably benign 0.00
R3982:Frmd6 UTSW 12 70887834 missense probably damaging 1.00
R4010:Frmd6 UTSW 12 70899553 missense probably benign
R4416:Frmd6 UTSW 12 70877249 missense probably benign 0.04
R4823:Frmd6 UTSW 12 70872575 missense probably benign 0.22
R4861:Frmd6 UTSW 12 70893726 missense probably damaging 0.98
R5368:Frmd6 UTSW 12 70864100 nonsense probably null
R5806:Frmd6 UTSW 12 70890020 missense probably damaging 1.00
R6226:Frmd6 UTSW 12 70863911 start gained probably benign
R6253:Frmd6 UTSW 12 70877213 missense probably damaging 0.99
R6781:Frmd6 UTSW 12 70899643 missense possibly damaging 0.68
R7051:Frmd6 UTSW 12 70897396 missense possibly damaging 0.78
R7156:Frmd6 UTSW 12 70877209 missense probably damaging 1.00
R7481:Frmd6 UTSW 12 70887055 missense probably damaging 1.00
U24488:Frmd6 UTSW 12 70893879 missense probably damaging 0.97
X0022:Frmd6 UTSW 12 70864108 missense probably damaging 1.00
Z1088:Frmd6 UTSW 12 70880678 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTGGCCTGAATTAGCTTCTCATC -3'
(R):5'- CAGCCCTTCGTTATCACACG -3'

Sequencing Primer
(F):5'- GAATTAGCTTCTCATCCTCTTGTCGG -3'
(R):5'- GCCCTTCGTTATCACACGTTACAAAC -3'
Posted On2014-10-30