Incidental Mutation 'R2342:Chd8'
ID 246798
Institutional Source Beutler Lab
Gene Symbol Chd8
Ensembl Gene ENSMUSG00000053754
Gene Name chromodomain helicase DNA binding protein 8
Synonyms 5830451P18Rik, Duplin
MMRRC Submission 040328-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2342 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 52435608-52495237 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 52442674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 625 (N625K)
Ref Sequence ENSEMBL: ENSMUSP00000122995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169] [ENSMUST00000227897]
AlphaFold Q09XV5
Predicted Effect probably benign
Transcript: ENSMUST00000089752
AA Change: N1965K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: N1965K

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147827
Predicted Effect probably benign
Transcript: ENSMUST00000149975
AA Change: N625K

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754
AA Change: N625K

DomainStartEndE-ValueType
low complexity region 74 93 N/A INTRINSIC
Blast:DEXDc 112 235 9e-40 BLAST
low complexity region 239 250 N/A INTRINSIC
low complexity region 363 374 N/A INTRINSIC
low complexity region 430 445 N/A INTRINSIC
Blast:SANT 456 515 1e-29 BLAST
low complexity region 547 563 N/A INTRINSIC
low complexity region 723 767 N/A INTRINSIC
low complexity region 882 899 N/A INTRINSIC
BRK 972 1016 1.34e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200169
AA Change: N1965K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: N1965K

DomainStartEndE-ValueType
low complexity region 255 272 N/A INTRINSIC
low complexity region 340 374 N/A INTRINSIC
low complexity region 404 437 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 534 N/A INTRINSIC
low complexity region 588 607 N/A INTRINSIC
CHROMO 642 708 1.8e-9 SMART
CHROMO 724 782 1.55e-4 SMART
DEXDc 809 1011 4.13e-37 SMART
HELICc 1165 1249 1.01e-22 SMART
low complexity region 1335 1345 N/A INTRINSIC
low complexity region 1422 1441 N/A INTRINSIC
Blast:DEXDc 1460 1505 4e-16 BLAST
low complexity region 1579 1590 N/A INTRINSIC
low complexity region 1703 1714 N/A INTRINSIC
low complexity region 1770 1785 N/A INTRINSIC
low complexity region 1887 1903 N/A INTRINSIC
low complexity region 2063 2107 N/A INTRINSIC
low complexity region 2222 2239 N/A INTRINSIC
BRK 2312 2356 1.34e-19 SMART
BRK 2381 2421 1.94e-2 SMART
low complexity region 2452 2472 N/A INTRINSIC
low complexity region 2494 2510 N/A INTRINSIC
low complexity region 2514 2529 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175303
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180857
Predicted Effect probably benign
Transcript: ENSMUST00000227897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227448
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 98,130,537 (GRCm39) E434K probably benign Het
Babam1 T A 8: 71,855,515 (GRCm39) M236K probably benign Het
Camk1 T C 6: 113,318,942 (GRCm39) probably benign Het
Dcaf8 A G 1: 172,013,928 (GRCm39) H373R possibly damaging Het
Dscam G A 16: 96,420,702 (GRCm39) T1728M probably damaging Het
Elf1 T C 14: 79,802,896 (GRCm39) probably benign Het
Epha2 C T 4: 141,050,842 (GRCm39) A866V probably benign Het
Frmd6 C A 12: 70,930,592 (GRCm39) Y237* probably null Het
Glg1 A T 8: 111,914,439 (GRCm39) C448* probably null Het
Gm4787 G T 12: 81,425,532 (GRCm39) R209S possibly damaging Het
Hhipl1 T C 12: 108,284,721 (GRCm39) L358P probably damaging Het
Hmgxb3 G A 18: 61,296,063 (GRCm39) T315I possibly damaging Het
Irak2 C A 6: 113,670,632 (GRCm39) T539K probably benign Het
Lrp1b C A 2: 40,809,208 (GRCm39) G2568C possibly damaging Het
Meis1 C T 11: 18,831,647 (GRCm39) A464T probably damaging Het
Or10g1b C A 14: 52,627,322 (GRCm39) A303S possibly damaging Het
Or6a2 T C 7: 106,600,116 (GRCm39) D317G probably benign Het
Orc4 A G 2: 48,817,152 (GRCm39) S179P probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pnliprp1 A G 19: 58,729,691 (GRCm39) probably benign Het
Prpf40b T A 15: 99,204,049 (GRCm39) V174D probably damaging Het
Rnf169 T C 7: 99,574,652 (GRCm39) K648E possibly damaging Het
Rtf1 A G 2: 119,542,598 (GRCm39) T301A probably benign Het
Sdccag8 T C 1: 176,747,207 (GRCm39) V528A probably benign Het
Sgsh A G 11: 119,238,540 (GRCm39) V308A probably benign Het
Shmt2 A G 10: 127,354,680 (GRCm39) V335A possibly damaging Het
Skint6 T A 4: 113,034,180 (GRCm39) T316S probably benign Het
Tbl2 G A 5: 135,187,607 (GRCm39) R288Q possibly damaging Het
Ttc3 C T 16: 94,232,857 (GRCm39) P1003L probably damaging Het
Usp34 A G 11: 23,353,599 (GRCm39) K1469E possibly damaging Het
Virma T C 4: 11,501,316 (GRCm39) Y92H probably damaging Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Wnt16 A G 6: 22,288,923 (GRCm39) E80G probably damaging Het
Zbtb10 C T 3: 9,330,255 (GRCm39) P538S possibly damaging Het
Zup1 G A 10: 33,804,113 (GRCm39) H454Y probably damaging Het
Other mutations in Chd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Chd8 APN 14 52,463,595 (GRCm39) missense probably damaging 0.99
IGL00694:Chd8 APN 14 52,455,427 (GRCm39) missense probably damaging 1.00
IGL01011:Chd8 APN 14 52,468,989 (GRCm39) missense possibly damaging 0.86
IGL01022:Chd8 APN 14 52,474,450 (GRCm39) missense probably benign
IGL01066:Chd8 APN 14 52,455,223 (GRCm39) missense probably damaging 1.00
IGL01083:Chd8 APN 14 52,458,877 (GRCm39) missense probably damaging 1.00
IGL01313:Chd8 APN 14 52,448,032 (GRCm39) missense probably damaging 1.00
IGL01396:Chd8 APN 14 52,442,044 (GRCm39) unclassified probably benign
IGL01476:Chd8 APN 14 52,442,947 (GRCm39) missense probably benign 0.32
IGL01731:Chd8 APN 14 52,450,111 (GRCm39) missense probably benign 0.12
IGL01895:Chd8 APN 14 52,436,551 (GRCm39) missense probably benign 0.00
IGL02090:Chd8 APN 14 52,464,691 (GRCm39) critical splice donor site probably null
IGL02344:Chd8 APN 14 52,439,107 (GRCm39) missense probably damaging 1.00
IGL02573:Chd8 APN 14 52,457,191 (GRCm39) missense possibly damaging 0.95
IGL02601:Chd8 APN 14 52,451,757 (GRCm39) missense possibly damaging 0.94
IGL02617:Chd8 APN 14 52,472,648 (GRCm39) missense probably benign 0.34
IGL02873:Chd8 APN 14 52,459,970 (GRCm39) missense probably damaging 0.99
IGL02974:Chd8 APN 14 52,439,158 (GRCm39) splice site probably null
IGL03058:Chd8 APN 14 52,455,730 (GRCm39) missense probably damaging 1.00
IGL03076:Chd8 APN 14 52,463,619 (GRCm39) splice site probably benign
IGL03239:Chd8 APN 14 52,465,005 (GRCm39) missense possibly damaging 0.92
PIT4431001:Chd8 UTSW 14 52,455,706 (GRCm39) missense probably damaging 0.98
PIT4468001:Chd8 UTSW 14 52,455,338 (GRCm39) missense possibly damaging 0.95
PIT4468001:Chd8 UTSW 14 52,445,453 (GRCm39) missense probably benign
R0006:Chd8 UTSW 14 52,472,750 (GRCm39) missense possibly damaging 0.51
R0006:Chd8 UTSW 14 52,472,750 (GRCm39) missense possibly damaging 0.51
R0022:Chd8 UTSW 14 52,470,312 (GRCm39) missense probably benign 0.00
R0115:Chd8 UTSW 14 52,474,663 (GRCm39) missense probably benign 0.00
R0131:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0131:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0132:Chd8 UTSW 14 52,442,783 (GRCm39) missense probably benign 0.15
R0419:Chd8 UTSW 14 52,441,517 (GRCm39) missense probably benign 0.24
R0440:Chd8 UTSW 14 52,442,283 (GRCm39) missense possibly damaging 0.91
R0452:Chd8 UTSW 14 52,452,044 (GRCm39) missense probably damaging 1.00
R0481:Chd8 UTSW 14 52,474,663 (GRCm39) missense probably benign 0.00
R0624:Chd8 UTSW 14 52,457,214 (GRCm39) missense possibly damaging 0.65
R0650:Chd8 UTSW 14 52,439,761 (GRCm39) missense probably benign 0.09
R0691:Chd8 UTSW 14 52,450,890 (GRCm39) missense probably damaging 0.96
R0790:Chd8 UTSW 14 52,441,482 (GRCm39) missense probably benign 0.07
R0835:Chd8 UTSW 14 52,441,482 (GRCm39) missense probably benign 0.07
R1180:Chd8 UTSW 14 52,458,565 (GRCm39) missense probably damaging 1.00
R1411:Chd8 UTSW 14 52,462,103 (GRCm39) missense probably benign
R1725:Chd8 UTSW 14 52,470,030 (GRCm39) missense probably benign 0.08
R1838:Chd8 UTSW 14 52,442,340 (GRCm39) missense probably benign 0.11
R1839:Chd8 UTSW 14 52,442,340 (GRCm39) missense probably benign 0.11
R1968:Chd8 UTSW 14 52,458,450 (GRCm39) missense probably damaging 0.98
R2020:Chd8 UTSW 14 52,452,698 (GRCm39) missense probably damaging 1.00
R2024:Chd8 UTSW 14 52,468,950 (GRCm39) missense probably benign 0.23
R2139:Chd8 UTSW 14 52,474,428 (GRCm39) missense probably benign 0.32
R2163:Chd8 UTSW 14 52,436,275 (GRCm39) missense possibly damaging 0.53
R2844:Chd8 UTSW 14 52,441,952 (GRCm39) missense possibly damaging 0.92
R3500:Chd8 UTSW 14 52,443,110 (GRCm39) missense probably benign 0.00
R3861:Chd8 UTSW 14 52,474,578 (GRCm39) missense probably benign 0.13
R4154:Chd8 UTSW 14 52,444,668 (GRCm39) unclassified probably benign
R4445:Chd8 UTSW 14 52,441,984 (GRCm39) splice site probably null
R4628:Chd8 UTSW 14 52,444,372 (GRCm39) missense probably benign 0.03
R4779:Chd8 UTSW 14 52,468,963 (GRCm39) missense probably damaging 1.00
R4783:Chd8 UTSW 14 52,442,825 (GRCm39) missense probably damaging 1.00
R4784:Chd8 UTSW 14 52,442,825 (GRCm39) missense probably damaging 1.00
R5001:Chd8 UTSW 14 52,441,372 (GRCm39) missense probably benign 0.09
R5280:Chd8 UTSW 14 52,442,582 (GRCm39) missense possibly damaging 0.68
R5331:Chd8 UTSW 14 52,439,571 (GRCm39) intron probably benign
R5348:Chd8 UTSW 14 52,470,155 (GRCm39) missense probably damaging 1.00
R5375:Chd8 UTSW 14 52,441,611 (GRCm39) missense probably damaging 1.00
R5470:Chd8 UTSW 14 52,450,066 (GRCm39) missense probably damaging 1.00
R5479:Chd8 UTSW 14 52,452,652 (GRCm39) missense probably benign 0.15
R5488:Chd8 UTSW 14 52,450,505 (GRCm39) intron probably benign
R5489:Chd8 UTSW 14 52,450,505 (GRCm39) intron probably benign
R5499:Chd8 UTSW 14 52,441,888 (GRCm39) critical splice donor site probably null
R5988:Chd8 UTSW 14 52,455,395 (GRCm39) missense probably damaging 1.00
R6046:Chd8 UTSW 14 52,458,528 (GRCm39) missense possibly damaging 0.60
R6125:Chd8 UTSW 14 52,444,491 (GRCm39) missense probably benign 0.16
R6212:Chd8 UTSW 14 52,439,155 (GRCm39) missense probably damaging 1.00
R6337:Chd8 UTSW 14 52,441,566 (GRCm39) missense probably damaging 1.00
R6394:Chd8 UTSW 14 52,440,042 (GRCm39) missense possibly damaging 0.66
R6576:Chd8 UTSW 14 52,453,533 (GRCm39) missense probably damaging 1.00
R6590:Chd8 UTSW 14 52,464,694 (GRCm39) missense possibly damaging 0.60
R6690:Chd8 UTSW 14 52,464,694 (GRCm39) missense possibly damaging 0.60
R6786:Chd8 UTSW 14 52,464,125 (GRCm39) missense probably benign 0.33
R6913:Chd8 UTSW 14 52,451,951 (GRCm39) missense probably damaging 0.99
R7090:Chd8 UTSW 14 52,452,677 (GRCm39) missense probably damaging 0.99
R7107:Chd8 UTSW 14 52,450,129 (GRCm39) missense probably benign 0.07
R7138:Chd8 UTSW 14 52,451,955 (GRCm39) missense possibly damaging 0.83
R7383:Chd8 UTSW 14 52,452,776 (GRCm39) missense probably damaging 1.00
R7392:Chd8 UTSW 14 52,470,312 (GRCm39) missense probably benign
R7471:Chd8 UTSW 14 52,441,569 (GRCm39) missense probably benign
R7625:Chd8 UTSW 14 52,474,534 (GRCm39) missense probably benign 0.04
R7790:Chd8 UTSW 14 52,463,539 (GRCm39) missense probably damaging 1.00
R7862:Chd8 UTSW 14 52,451,734 (GRCm39) missense probably damaging 1.00
R7937:Chd8 UTSW 14 52,464,963 (GRCm39) missense probably benign 0.02
R8092:Chd8 UTSW 14 52,455,184 (GRCm39) missense probably damaging 1.00
R8237:Chd8 UTSW 14 52,450,809 (GRCm39) missense probably damaging 1.00
R8321:Chd8 UTSW 14 52,470,024 (GRCm39) missense probably benign 0.01
R8371:Chd8 UTSW 14 52,470,275 (GRCm39) missense probably benign
R8425:Chd8 UTSW 14 52,448,012 (GRCm39) missense probably damaging 1.00
R8674:Chd8 UTSW 14 52,450,463 (GRCm39) missense probably damaging 0.98
R8794:Chd8 UTSW 14 52,441,904 (GRCm39) missense probably damaging 0.98
R8828:Chd8 UTSW 14 52,448,037 (GRCm39) frame shift probably null
R8909:Chd8 UTSW 14 52,450,389 (GRCm39) missense possibly damaging 0.82
R9194:Chd8 UTSW 14 52,439,650 (GRCm39) missense probably benign 0.01
R9278:Chd8 UTSW 14 52,472,627 (GRCm39) missense probably benign 0.01
R9489:Chd8 UTSW 14 52,457,055 (GRCm39) missense probably damaging 0.98
R9501:Chd8 UTSW 14 52,452,045 (GRCm39) missense probably benign 0.04
R9546:Chd8 UTSW 14 52,453,408 (GRCm39) missense probably damaging 1.00
R9605:Chd8 UTSW 14 52,457,055 (GRCm39) missense probably damaging 0.98
R9694:Chd8 UTSW 14 52,441,341 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGTCAGACTCTCCAGATTGGG -3'
(R):5'- TTGAGTTGCTTCGACGCTTAC -3'

Sequencing Primer
(F):5'- GGACCTGAACAGTACTTTCCTCAGG -3'
(R):5'- CGGGAACAAGTTTTATGCCAC -3'
Posted On 2014-10-30