Incidental Mutation 'R2342:Vmn2r112'
ID246804
Institutional Source Beutler Lab
Gene Symbol Vmn2r112
Ensembl Gene ENSMUSG00000094921
Gene Namevomeronasal 2, receptor 112
SynonymsEG628185
MMRRC Submission 040328-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2342 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location22601148-22619133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22603115 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 258 (V258E)
Ref Sequence ENSEMBL: ENSMUSP00000094994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097381]
Predicted Effect probably damaging
Transcript: ENSMUST00000097381
AA Change: V258E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094994
Gene: ENSMUSG00000094921
AA Change: V258E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 2.8e-32 PFAM
Pfam:NCD3G 512 565 5.8e-21 PFAM
Pfam:7tm_3 598 833 6.5e-54 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 C T 13: 97,994,029 E434K probably benign Het
Babam1 T A 8: 71,402,871 M236K probably benign Het
Camk1 T C 6: 113,341,981 probably benign Het
Chd8 A C 14: 52,205,217 N625K probably benign Het
Dcaf8 A G 1: 172,186,361 H373R possibly damaging Het
Dscam G A 16: 96,619,502 T1728M probably damaging Het
Elf1 T C 14: 79,565,456 probably benign Het
Epha2 C T 4: 141,323,531 A866V probably benign Het
Frmd6 C A 12: 70,883,818 Y237* probably null Het
Glg1 A T 8: 111,187,807 C448* probably null Het
Gm4787 G T 12: 81,378,758 R209S possibly damaging Het
Hhipl1 T C 12: 108,318,462 L358P probably damaging Het
Hmgxb3 G A 18: 61,162,991 T315I possibly damaging Het
Irak2 C A 6: 113,693,671 T539K probably benign Het
Lrp1b C A 2: 40,919,196 G2568C possibly damaging Het
Meis1 C T 11: 18,881,647 A464T probably damaging Het
Olfr1511 C A 14: 52,389,865 A303S possibly damaging Het
Olfr2 T C 7: 107,000,909 D317G probably benign Het
Orc4 A G 2: 48,927,140 S179P probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pnliprp1 A G 19: 58,741,259 probably benign Het
Prpf40b T A 15: 99,306,168 V174D probably damaging Het
Rnf169 T C 7: 99,925,445 K648E possibly damaging Het
Rtf1 A G 2: 119,712,117 T301A probably benign Het
Sdccag8 T C 1: 176,919,641 V528A probably benign Het
Sgsh A G 11: 119,347,714 V308A probably benign Het
Shmt2 A G 10: 127,518,811 V335A possibly damaging Het
Skint6 T A 4: 113,176,983 T316S probably benign Het
Tbl2 G A 5: 135,158,753 R288Q possibly damaging Het
Ttc3 C T 16: 94,431,998 P1003L probably damaging Het
Usp34 A G 11: 23,403,599 K1469E possibly damaging Het
Virma T C 4: 11,501,316 Y92H probably damaging Het
Wnt16 A G 6: 22,288,924 E80G probably damaging Het
Zbtb10 C T 3: 9,265,195 P538S possibly damaging Het
Zufsp G A 10: 33,928,117 H454Y probably damaging Het
Other mutations in Vmn2r112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Vmn2r112 APN 17 22618936 missense probably benign 0.13
IGL01021:Vmn2r112 APN 17 22618904 missense probably damaging 1.00
IGL01122:Vmn2r112 APN 17 22603007 missense probably benign 0.00
IGL01360:Vmn2r112 APN 17 22618622 missense probably benign 0.03
IGL01536:Vmn2r112 APN 17 22605155 missense probably damaging 1.00
IGL02148:Vmn2r112 APN 17 22619032 missense probably damaging 1.00
IGL02465:Vmn2r112 APN 17 22614994 missense probably damaging 1.00
PIT4576001:Vmn2r112 UTSW 17 22614931 missense probably benign 0.00
R0278:Vmn2r112 UTSW 17 22603006 missense probably benign 0.44
R0328:Vmn2r112 UTSW 17 22605270 missense probably benign 0.01
R0583:Vmn2r112 UTSW 17 22618949 missense probably damaging 1.00
R0831:Vmn2r112 UTSW 17 22614999 missense probably damaging 0.99
R1080:Vmn2r112 UTSW 17 22618999 missense probably damaging 1.00
R1245:Vmn2r112 UTSW 17 22603247 missense probably benign 0.03
R1321:Vmn2r112 UTSW 17 22618519 nonsense probably null
R1381:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R1514:Vmn2r112 UTSW 17 22602844 missense probably benign 0.40
R1519:Vmn2r112 UTSW 17 22618903 missense possibly damaging 0.83
R1572:Vmn2r112 UTSW 17 22603144 missense possibly damaging 0.61
R1590:Vmn2r112 UTSW 17 22615008 critical splice donor site probably null
R1640:Vmn2r112 UTSW 17 22605116 missense probably benign 0.01
R2221:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2223:Vmn2r112 UTSW 17 22601233 missense possibly damaging 0.86
R2310:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2312:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2337:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2339:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2340:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2341:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2401:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2860:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2861:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R2926:Vmn2r112 UTSW 17 22615003 missense possibly damaging 0.90
R3236:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3237:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3977:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R3979:Vmn2r112 UTSW 17 22603115 missense probably damaging 0.98
R4168:Vmn2r112 UTSW 17 22603088 missense probably benign 0.01
R4256:Vmn2r112 UTSW 17 22618412 missense probably damaging 1.00
R4386:Vmn2r112 UTSW 17 22601322 missense probably benign 0.36
R4912:Vmn2r112 UTSW 17 22603382 missense probably damaging 0.99
R4947:Vmn2r112 UTSW 17 22602879 missense probably benign 0.02
R5446:Vmn2r112 UTSW 17 22618250 missense probably damaging 1.00
R5870:Vmn2r112 UTSW 17 22619023 missense probably benign 0.00
R6351:Vmn2r112 UTSW 17 22601278 missense probably benign
R6384:Vmn2r112 UTSW 17 22605155 missense probably damaging 1.00
R6390:Vmn2r112 UTSW 17 22605249 missense probably benign 0.01
R6401:Vmn2r112 UTSW 17 22603551 nonsense probably null
R6405:Vmn2r112 UTSW 17 22618235 missense probably damaging 1.00
R6620:Vmn2r112 UTSW 17 22603101 missense probably benign 0.00
R6648:Vmn2r112 UTSW 17 22618486 missense probably damaging 1.00
R6649:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6653:Vmn2r112 UTSW 17 22601179 missense probably null 1.00
R6654:Vmn2r112 UTSW 17 22603469 missense possibly damaging 0.89
R6700:Vmn2r112 UTSW 17 22603481 missense possibly damaging 0.53
R6993:Vmn2r112 UTSW 17 22603214 missense probably benign 0.01
R7052:Vmn2r112 UTSW 17 22602526 missense probably benign
R7454:Vmn2r112 UTSW 17 22603307 missense probably benign 0.00
R7763:Vmn2r112 UTSW 17 22603118 missense probably damaging 1.00
R8032:Vmn2r112 UTSW 17 22603394 missense probably benign 0.21
Z1088:Vmn2r112 UTSW 17 22605078 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GATGGCCTCTGATCATACATCTC -3'
(R):5'- TGACTGAGTTCAATGTCTGCAC -3'

Sequencing Primer
(F):5'- GGCCTCTGATCATACATCTCTAGCC -3'
(R):5'- CCAGAAATCTCACTATTGTGTTGTTG -3'
Posted On2014-10-30