Incidental Mutation 'R2354:Gal3st2b'
ID 246812
Institutional Source Beutler Lab
Gene Symbol Gal3st2b
Ensembl Gene ENSMUSG00000093805
Gene Name galactose-3-O-sulfotransferase 2B
Synonyms Gm9994
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R2354 (G1)
Quality Score 187
Status Validated
Chromosome 1
Chromosomal Location 93918311-93942650 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 93939786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 52 (T52A)
Ref Sequence ENSEMBL: ENSMUSP00000136012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177958] [ENSMUST00000178757]
AlphaFold Q6XQH0
Predicted Effect probably damaging
Transcript: ENSMUST00000177958
AA Change: T54A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136311
Gene: ENSMUSG00000093805
AA Change: T54A

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 1 382 6.5e-151 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178757
AA Change: T52A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136012
Gene: ENSMUSG00000093805
AA Change: T52A

DomainStartEndE-ValueType
Pfam:Gal-3-0_sulfotr 13 380 1.1e-151 PFAM
Meta Mutation Damage Score 0.7906 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Gal3st2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0593:Gal3st2b UTSW 1 93940827 missense probably benign 0.05
R1631:Gal3st2b UTSW 1 93940783 missense probably damaging 0.98
R1753:Gal3st2b UTSW 1 93940616 missense probably damaging 1.00
R3926:Gal3st2b UTSW 1 93940790 missense probably benign 0.06
R4347:Gal3st2b UTSW 1 93939808 missense probably damaging 1.00
R6132:Gal3st2b UTSW 1 93939966 missense possibly damaging 0.57
R7069:Gal3st2b UTSW 1 93940619 missense possibly damaging 0.95
R7116:Gal3st2b UTSW 1 93940776 missense possibly damaging 0.58
R7662:Gal3st2b UTSW 1 93940892 missense probably damaging 1.00
R7775:Gal3st2b UTSW 1 93940784 missense probably damaging 1.00
R8669:Gal3st2b UTSW 1 93941042 missense possibly damaging 0.90
R8924:Gal3st2b UTSW 1 93940931 missense probably benign 0.18
R8937:Gal3st2b UTSW 1 93940848 missense probably benign 0.15
Z1176:Gal3st2b UTSW 1 93938685 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCAGTCACAGAGAATCCCTTG -3'
(R):5'- TAAAGTGATGCTGCAGGTGG -3'

Sequencing Primer
(F):5'- CCTTGGACCTAAAGACTACAGAGTG -3'
(R):5'- TGGGCGTCCTGCTTCAG -3'
Posted On 2014-10-30