Incidental Mutation 'R2354:B4galt3'
ID 246813
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene Name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms 9530061M23Rik, R74981, ESTM26, beta4GalT-III
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.328) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171270328-171276896 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 171274043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000106945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141114] [ENSMUST00000141999] [ENSMUST00000151863] [ENSMUST00000192956]
AlphaFold Q91YY2
Predicted Effect probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138904
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Meta Mutation Damage Score 0.5682 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171271792 missense probably damaging 1.00
BB004:B4galt3 UTSW 1 171271772 nonsense probably null
BB014:B4galt3 UTSW 1 171271772 nonsense probably null
R0026:B4galt3 UTSW 1 171274261 unclassified probably benign
R0126:B4galt3 UTSW 1 171276165 missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171274251 unclassified probably benign
R1478:B4galt3 UTSW 1 171276365 missense probably benign 0.11
R2012:B4galt3 UTSW 1 171272548 missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171275942 missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4371:B4galt3 UTSW 1 171274043 missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171271773 missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171272710 missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171272519 critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171272749 missense probably damaging 1.00
R7927:B4galt3 UTSW 1 171271772 nonsense probably null
R8222:B4galt3 UTSW 1 171272683 missense possibly damaging 0.46
R8552:B4galt3 UTSW 1 171274347 missense possibly damaging 0.70
R8804:B4galt3 UTSW 1 171276374 missense probably benign 0.33
R8859:B4galt3 UTSW 1 171271671 missense unknown
R9150:B4galt3 UTSW 1 171276326 missense probably benign
R9265:B4galt3 UTSW 1 171274047 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTGGGTGCTCTCTTCA -3'
(R):5'- AACTCCGCCAAAGTACTGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'
Posted On 2014-10-30