Incidental Mutation 'R2354:Slc5a12'
ID 246814
Institutional Source Beutler Lab
Gene Symbol Slc5a12
Ensembl Gene ENSMUSG00000041644
Gene Name solute carrier family 5 (sodium/glucose cotransporter), member 12
Synonyms SMCT2
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock # R2354 (G1)
Quality Score 112
Status Validated
Chromosome 2
Chromosomal Location 110597298-110647779 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110609432 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 141 (V141A)
Ref Sequence ENSEMBL: ENSMUSP00000047340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045972] [ENSMUST00000111026]
AlphaFold Q49B93
Predicted Effect probably damaging
Transcript: ENSMUST00000045972
AA Change: V141A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047340
Gene: ENSMUSG00000041644
AA Change: V141A

DomainStartEndE-ValueType
Pfam:SSF 41 449 6.5e-43 PFAM
transmembrane domain 507 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111026
AA Change: V141A

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106655
Gene: ENSMUSG00000041644
AA Change: V141A

DomainStartEndE-ValueType
Pfam:SSF 41 445 6.2e-48 PFAM
transmembrane domain 503 525 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146664
Meta Mutation Damage Score 0.1978 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Normal blood lactate is maintained at about 1.5 mM, and little filtered lactate is excreted in urine. Reabsorption of lactate is mediated by the low-affinity Na(+)-coupled lactate transporter SLC5A12 in the initial part of the proximal tubule and by the high-affinity Na(+)-coupled lactate transporter SLC5A8 (MIM 608044) in the distal proximal tubule (Gopal et al., 2007 [PubMed 17692818]).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Slc5a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc5a12 APN 2 110597822 missense probably damaging 1.00
IGL01337:Slc5a12 APN 2 110620373 nonsense probably null
IGL01830:Slc5a12 APN 2 110597806 missense probably damaging 1.00
IGL02456:Slc5a12 APN 2 110616834 splice site probably benign
IGL02619:Slc5a12 APN 2 110640856 missense probably benign 0.00
IGL02832:Slc5a12 APN 2 110640815 missense probably benign
IGL02890:Slc5a12 APN 2 110624133 splice site probably benign
IGL03058:Slc5a12 APN 2 110640792 missense probably benign 0.23
R0607:Slc5a12 UTSW 2 110632743 missense probably benign 0.30
R1342:Slc5a12 UTSW 2 110617090 splice site probably null
R1532:Slc5a12 UTSW 2 110610138 missense possibly damaging 0.64
R1992:Slc5a12 UTSW 2 110621744 missense probably benign 0.04
R3830:Slc5a12 UTSW 2 110632736 nonsense probably null
R4728:Slc5a12 UTSW 2 110644424 nonsense probably null
R4822:Slc5a12 UTSW 2 110621740 missense possibly damaging 0.90
R4937:Slc5a12 UTSW 2 110620408 missense probably damaging 1.00
R5860:Slc5a12 UTSW 2 110597624 missense probably benign 0.30
R6075:Slc5a12 UTSW 2 110616747 missense probably damaging 1.00
R6168:Slc5a12 UTSW 2 110616744 missense probably damaging 1.00
R6853:Slc5a12 UTSW 2 110624194 missense probably benign 0.37
R6870:Slc5a12 UTSW 2 110641810 missense probably damaging 0.99
R7014:Slc5a12 UTSW 2 110644364 missense probably benign 0.00
R7135:Slc5a12 UTSW 2 110616714 missense possibly damaging 0.86
R8936:Slc5a12 UTSW 2 110637110 missense probably damaging 1.00
R9000:Slc5a12 UTSW 2 110624180 missense probably damaging 1.00
R9145:Slc5a12 UTSW 2 110640897 missense probably benign 0.21
R9362:Slc5a12 UTSW 2 110616699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGACTCACTTGGGATTCA -3'
(R):5'- CTGTGTGTTTATAAGCAAGAAGATTTG -3'

Sequencing Primer
(F):5'- AGGTCCTCTGCATATATGTCATGAC -3'
(R):5'- GTATCTCCCCCACAAGAT -3'
Posted On 2014-10-30