Incidental Mutation 'R2354:Galk2'
ID 246815
Institutional Source Beutler Lab
Gene Symbol Galk2
Ensembl Gene ENSMUSG00000027207
Gene Name galactokinase 2
Synonyms 2810017M24Rik, Gk2
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 125859109-125984299 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 125931273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 208 (S208R)
Ref Sequence ENSEMBL: ENSMUSP00000092186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028636] [ENSMUST00000094604] [ENSMUST00000131643] [ENSMUST00000134337]
AlphaFold Q68FH4
Predicted Effect probably benign
Transcript: ENSMUST00000028636
AA Change: S197R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207
AA Change: S197R

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094604
AA Change: S208R

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092186
Gene: ENSMUSG00000027207
AA Change: S208R

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 24 73 3.2e-25 PFAM
Pfam:GHMP_kinases_N 131 198 4.8e-15 PFAM
Pfam:GHMP_kinases_C 344 430 3.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110454
Predicted Effect probably benign
Transcript: ENSMUST00000131643
Predicted Effect probably benign
Transcript: ENSMUST00000134337
SMART Domains Protein: ENSMUSP00000120728
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 34 85 4.9e-26 PFAM
Pfam:GHMP_kinases_N 142 182 1.5e-10 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly efficient N-acetylgalactosamine (GalNAc) kinase, which has galactokinase activity when galactose is present at high concentrations. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Galk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Galk2 APN 2 125896765 missense probably benign 0.29
IGL01663:Galk2 APN 2 125983179 missense probably benign
IGL01669:Galk2 APN 2 125887887 missense probably damaging 1.00
IGL01831:Galk2 APN 2 125975357 missense probably benign 0.01
IGL02055:Galk2 APN 2 125931404 missense probably benign 0.01
IGL02298:Galk2 APN 2 125859370 missense probably benign 0.00
IGL03093:Galk2 APN 2 125929643 missense probably damaging 1.00
R0305:Galk2 UTSW 2 125887888 missense probably damaging 1.00
R1713:Galk2 UTSW 2 125931290 missense probably benign 0.00
R1870:Galk2 UTSW 2 125975263 missense probably benign
R2327:Galk2 UTSW 2 125975395 missense probably damaging 1.00
R3962:Galk2 UTSW 2 125893373 missense probably benign 0.13
R4870:Galk2 UTSW 2 125929637 nonsense probably null
R5034:Galk2 UTSW 2 125929575 missense probably benign 0.00
R5427:Galk2 UTSW 2 125946821 missense probably benign 0.01
R5619:Galk2 UTSW 2 125975397 nonsense probably null
R6145:Galk2 UTSW 2 125946842 missense possibly damaging 0.90
R6173:Galk2 UTSW 2 125859217 start gained probably benign
R6287:Galk2 UTSW 2 125870348 intron probably benign
R7174:Galk2 UTSW 2 125896701 missense probably damaging 1.00
R7453:Galk2 UTSW 2 125887861 missense possibly damaging 0.51
R7480:Galk2 UTSW 2 125946925 missense probably benign
R7519:Galk2 UTSW 2 125983252 missense possibly damaging 0.60
R7815:Galk2 UTSW 2 125975401 missense probably damaging 1.00
R8094:Galk2 UTSW 2 125931269 missense probably damaging 1.00
R8323:Galk2 UTSW 2 125866378 missense probably benign
R8478:Galk2 UTSW 2 125929585 nonsense probably null
R9292:Galk2 UTSW 2 125975298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACTGTGATACTTACAATGTGG -3'
(R):5'- GCATGCTGCAAGTTCCATTGG -3'

Sequencing Primer
(F):5'- TCTCAGCAACTGTGGCAGAG -3'
(R):5'- GCAAGTTCCATTGGTTTGCCAC -3'
Posted On 2014-10-30